PCR reaction mix, 8 tubes, 50 μL each: This mix contains Taq DNA polymerase, MgCl2, and dNTP’s[1]
DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer.
A strip of empty PCR tubes
Disposable pipette tips: only use each pipette one time- even disposable pipette tips. The risks of doing this include cross-contamination.
Cup for discarded tips
Micropipettor
OpenPCR machine: shared by two groups
PCR Reaction Sample List
Tube Label
PCR Reaction Sample
Patient ID
G1 +
Positive control
none
G1 -
Negative control
none
G1 1-1
Patient 1, replicate 1
54647
G1 1-2
Patient 1, replicate 2
54647
G1 1-3
Patient 1, replicate 3
54647
G1 2-1
Patient 2, replicate 1
67052
G1 2-2
Patient 2, replicate 2
67052
G1 2-3
Patient 2, replicate 3
67052
DNA Sample Set-up Procedure
Individual PCR reactions will take place three time for each patient (for replicants 1, 2 and 3); there will be a total of six PCR reactions.
For each patient and specified replicant (1,2 or 3):
Add DNA primer mix (50 μL) specific to patient and replicant to test tube
Add PCR reaction mix (50 μL) to test tube
Place test tube into DNA Thermal Cycler and click “Start”
During the thermal cycling process, multiple cycles are completed in order to obtain billions of replicated DNA. This process can be completed within a few hours, through the correct application of heat at different intervals. In general, the process begins by adding a DNA fragment, two polymers, nucleotides and DNA polymerase to a test tube, which is then placed into the Thermal Cycler. Similarly, this experiment will be completed by placing the correct DNA primer mix and PCR reaction mix into a test tube, which will then be placed into the Thermal Cycler and a simple "Start" button can begin the reaction. During cycle 1- shown in Figure 1 above- the cycler heats the sample to 95॰C in order to split the DNA into two strands. Then, the cycler cools the DNA to 50॰C, and primers attach to each DNA strand before both strands can reattach to one another. The cycler then heats the DNA to 72॰C in order to activate the Taq DNA polymerase in this reaction. Cycle 1 ends at this point- and then cycle 2 is completed through the same process. When the thermal cycling program is finished, thirty cycles will be completed and billions of DNA fragments (with the target sequence) replicated. The final image of this completed process is shown in Figure 2, above.
Note: Both Figure 1 and Figure 2 are taken from the PCR virtual lab created by the Genetic Science Learning Center from the University of Utah [4].
HEATED LID: 100॰C
INITIAL STEP: 95॰C for 2 minutes
NUMBER OF CYCLES: 25
Denature at 95॰C for 30 seconds, Anneal at 57॰C for 30 seconds, and
Extend at 72॰C for 30 seconds
FINAL STEP: 72॰C for 2 minutes
FINAL HOLD: 4॰C
Research and Development
PCR - The Underlying Technology
There are several components to the Polymerase Chain Reaction. Template DNA, the first component, acts as the basis for the whole DNA replication process. Primers, another component, attach to the sites of the DNA strand at either end of the DNA segment that is the target DNA sequence for copying. Then, Taq DNA Polymerase finds the primers and then begins reading the DNA and attaches the complementary nucleotides to create copies of the DNA. These nucleotides are deoxyribonucleotides and are the genetic building blocks that are used in this process to produce copies of the target DNA sequence.
Polymerase Chain Reactions have six steps of thermal cycling. In the initial step, the DNA sample is heated at 95°C for 2 minutes. During this step, the double helix of the template DNA is unwound and separated into two separate strands of DNA. This initial step can only be done at the beginning of the process. In the second step, the DNA sample is heated again at 95°C for 30 seconds. This step is the denaturing step. The double helix of the template DNA is unwound and separated into two separate strands of DNA. This denature step is to be repeated in each thermal cycle. In the third step, the DNA sample is heated at 57°C for 30 seconds. This step is called the anneal step. During this step, primer sequences lock onto their targets on the single stranded DNA strands. The anneal step is to be repeated for each thermal cycle. In the fourth step, the DNA is heated at 72°C for 30 seconds. This step is known as the extension step. During this step, Taq DNA polymerase is activated and locates a primer attached to a single-stranded DNA. It then begins to read the DNA and attach complementary deoxyribonucleotides until it gets to the end of the strand and falls off. The extend step is to be repeated for each thermal cycle. In the final step, the DNA sample is heated again at 72°C for 2 minutes. During this step, Taq DNA polymerase is activated and locates a primer attached to a single-stranded DNA. It then begins to read the DNA and attach complementary deoxyribonucleotides until it gets to the end of the strand and falls off. This final step is to be done only once at the end of the process. After the end of the process, there is a final hold step where the sample is stored at 4°C.
DNA is made up of four types of molecules called nucleotides: Adenine, Thymine, Cytosine, and Guanine. Adenine is abbreviated as A, Thymine as T, Cytosine as C, and Guanine as G. Base-pairing which is driven by hydrogen bonding, allows these base pairs to stick to its complementary pair. Adenine anneals to Thymine. Thymine anneals to Adenine. Cytosine anneals to Guanine. Guanine anneals to Cytosine.
Base-pairing occurs between the annealing and extension steps. In the annealing stage, the system is cooled and the target DNA is binded with short DNA primers which serve as the starting positions in order for the replication to occur. The temperature is now elevated which is where the thermal cycling stage of extension occurs and this is where two Taq Polymerase match the base primers with their pairs and now extend the primers that are forming the new nucleotide strands of DNA.[5]
The above image shows the different components of a Polymerase Chain Reaction: DNA sample, primers, nucleotides, and Taq Polymerase. The image also shows what happens during the first cycle of PCR. The denaturing step where the DNA strands separate. The annealing step where primers bind to the DNA template. The extension step where the Taq Polymerase builds a new strand of the target DNA sequence.
The above image shows the first cycle of a Polymerase Chain Reaction as well, but goes on to show what happens (how many copies made) after a second cycle, a third, a fourth, and goes all the way to show what happens after 35 cycles.
SNP Information & Primer Design
Background: About the Disease SNP
A nucleotide is defined as a the product that occurs when a nucleoside binds to a phosphate group, which forms the basic structural unit of nucleic acids such as DNA [8]. A polymorphism is defined as the presence of a genetic variation within a population, upon which natural selection can operate. Therefore, a single nucleotide polymorphism is a variation in a DNA sequence that occurs with a difference in a single nucleotide (in the genome) between members of a species; SNPs can also occur between paired chromosomes in the individual. The given variation rs769452 is found in homo sapiens, and is based on chromosome 19, with a position of 44907853. The clinical significance of the SNP is pathogenic- rather, disease-causing- and it is linked to Alzheimer's disease. An allele is defined as one of two or more alternative forms of a gene which is derived through mutation, where both forms are found at the same place on a chromosome; the disease-associated allele contains the codon "CCG", with a numerical position 44907853. The APOE (apolipoprotein E) gene provides directions for making the protein apolipoprotein E, and the allele of APOE is linked to Alzheimer's Disease. [9]
Primer Design and Testing
The position exactly 200 bases to the right of the disease SNP is 44908053. The non-disease forward primer found from the primer test was AGCGGCCAGCGCTGGGAACT, and the non-disease reverse primer was CAGGCCCCCCAAGACTTAGC. Additionally, the disease-forward primer was AGCGGCCAGCGCTGGGAACC, and the disease-reverse primer was CAGGCCCCCCAAGACTTAGC. Figure 5 above displays the results of this primer test. [10]
BME 100 Fall 2017
