BME100 f2017:Group12 W1030 L4

From OpenWetWare
Jump to navigationJump to search
Owwnotebook icon.png BME 100 Fall 2017 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help
BME494 Asu logo.png


Dunder Mifflin Tempe

Name: Jasmine Barboa
Name: Alivia Ankrum
Name: Stephanie Santiago
Name: Jake Taylor
Name: Alec McCall

LAB 4 WRITE-UP

Protocol

Materials

  • Lab coat and disposable
  • PCR reaction mix, 8 tubes,50uL each: Mix contains Taq DNA polymerase, MgCl_2, and dNTP's
  • DNA/ primer mix, 8 tubes, 50 uL each: Each mix contains a different template DNA. ALL tubes have the same forward primer and reverse primer
  • A strip of empty PCR tubes
  • Disposable pipette tips: only use each only once. Never reuse disposable pipette tips. If you do, the samples will become cross-contaminated
  • Cup for discarded tips
  • Micropipettor
  • OpenPCR machine: shared by two groups

PCR Reaction Sample List

Tube Label PCR Reaction Sample Patient ID
G12 + Positive control none
G12 - Negative control none
G12 1-1 Patient 1, replicate 1 76522
G12 1-2 Patient 1, replicate 2 76522
G12 1-3 Patient 1, replicate 3 76522
G12 2-1 Patient 2, replicate 1 79360
G12 2-2 Patient 2, replicate 2 79360
G12 2-3 Patient 2, replicate 3 79360


DNA Sample Set-up Procedure

  1. Move your extracted DNA into a special PCR tube
  2. Move your extracted DNA to the PCR tubes using a pipette
  3. Add Primer 1 to the PCR tube
  4. Add Primer 2 to the PCR tube
  5. Add nucleotides to your PCR tube
  6. Add DNA Polymerase to the PCR tube
  7. Place the PCR tube into the DNA Thermal Cycler


OpenPCR program

HEATED LID: 100°C

INITIAL STEP: 95°C

NUMBER OF CYCLES: 25

    Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and 
    Extend at 72°C for 30 seconds 

FINAL STEP: 72°C for 2 minutes

FINAL HOLD: 4°C






Research and Development

PCR - The Underlying Technology

Q1: What is the function of each component of a PCR reaction?

Template DNA: The beginning strand of DNA before synthesis

Primers: A short strand of RNA or DNA that is the starting point for DNA synthesis

Taq Polymerase: The enzyme that assembles nucleotides into new strands of DNA


Deoxyribonucleatides (dNTP's): Polymerize to form DNA


Q2: What happens to the components (listed above) during each step of thermal cycling?

INITIAL STEP- 95°C for 2 minutes: The template DNA strand is heating up and straightening out

Denature at 95°C for 30 seconds: The template DNA eventually separates at such a high temperature

Anneal at 57°C for 30 seconds: At this time the primers will attach themselves to the separated DNA strands

Extend at 72°C for 30 seconds: At this temperature the enzyme Taq Polymerase attaches itself the primers.

FINAL STEP- 72°C for 2 minutes: The Taq Polymerase adds nucleotides to make the second strand for each strand

FINAL HOLD- 4°C: The process is resetting at this temperature to be able to repeat itself



SNP Information & Primer Design

3.
What is a nucleotide? Nucleotides are the structural units of DNA, which include the As, Gs, Ts, and Cs, a carbon sugar, and a phosphate group
What is a polymorphism? The presence of genetic variation within the population

4.
What species is this variation found in? Homo Sapiens
What chromosome is the variation located on? 19:44907853
What is listed as the Clinical significance of this SNP? Pathogenic

Background: About the Disease SNP
This SNP is linked to the development of Alzheimer's disease, specifically, 30-50% of patients who develop late-onset AD. There are actually several SNPs that are present in this gene that act as biomarkers for genetically determining the predicted onset of this disease. The APOE-e4 copies increases the risk of developing Alzheimer's by 25-fold. This SNP specifically, causes subarachnoid hemorrhage, and tests of association can be ran to find the apolipoprotein E and elastic genes that lead to the onset of Alzheimer's.

6.
What does APOE stand for?
Apolipoprotein-E
What is the function of APOE?
APOE is a major apoprotein of the chylomicron and binds to a specific liver and peripheral cell receptor, which is essential for regular catabolism of the lipoprotein. This gene is found in chromosome 19 in a cluster with the related apolipoprotein C1 and C2 genes. Mutations cause familial dysbetalipoproteinemia, or Type III hyperlipoproteinemia (HLP III). This increases plasma cholesterol and triglycerides, which are the consequences of wronged clearance of chylomicron and VLDL remnants.

7.
What is an allele?
An alternative form of a gene that is present by mutation and are found within that chromosome in the same location
The disease-associated allele contains what codon?
CCG

8.
The numerical position of the SNP is: 44907853

11.
Non-disease forward 5'>AGCGGCCAGCGCTGGGAACT<3'

12.
Numerical position 200 bases to the right of the disease SNP is: 44908053

13.
Non-Disease reverse primer: 5'>CAGGCCCCCCAAGACTTAGC<3'

14.
Disease Forward Primer: 5'>AGCGGCCAGCGCTGGGAACC<3'
Disease Reverse Primer: 5'>CAGGCCCCCCAAGACTTAGC<3'

Primer Design and Testing
When we tested the non-disease forward and reverse primers, the database found the result within the correct chromosome, chromosome 19. This makes sense because this is the sequence of the gene without the mutation, and therefore, it would make sense that it would be found in the database because these are the primers without the mutation as well. Then, when we tested the disease primers, there were no results found. This is accurate because since the primers include the mutation, it does not match up with the human genome because it does not include the mutation.

Goodresultsg12.png Badg12.png