BME100 f2017:Group10 W1030 L4

BME 100 Fall 2017	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Error creating thumbnail: Unable to save thumbnail to destination Name: Sarah Desmond Error creating thumbnail: Unable to save thumbnail to destination Name: Eddie Aparicio Error creating thumbnail: Unable to save thumbnail to destination Name: Patrick Mullane Error creating thumbnail: Unable to save thumbnail to destination Name: Adrienne Parkinson Error creating thumbnail: Unable to save thumbnail to destination Name: Leslie Olivares LAB 4 WRITE-UP Protocol Materials Lab coat and disposable gloves PCR reaction mix, 8 tubes, 50 microliters each: containing Taq DNA polymerase, MgCl2, and dNTP's DNA/primer mix, 8 tubes, 50 microliters each: all tubes contain the same forward and reverse primer and different template DNA A strip of empty PCR tubes Disposable pipette tips: never reuse disposable pipette tips Cup for discarded tips Micropipettor OpenPCR machine: shared by two groups PCR Reaction Sample List Tube Label PCR Reaction Sample Patient ID G10 + Positive control none G10 - Negative control none G10 1-1 Patient 1, replicate 1 72874 G10 1-2 Patient 1, replicate 2 72874 G10 1-3 Patient 1, replicate 3 72874 G10 2-1 Patient 2, replicate 1 64687 G10 2-2 Patient 2, replicate 2 64687 G10 2-3 Patient 2, replicate 3 64687 DNA Sample Set-up Procedure Label 8 different empty PCR tubes as described in the column "Tube Label" from the PCR Reaction Sample List above. Add 50 microliters of PCR reaction mix (containing Taq DNA Polymerase, MgCl2, and dNTP's) to each tube. Add 50 microliters of the first DNA/primer mix (containing forward and reverse primers and unique template DNA) to the "G10 +" tube. Repeat step 3 for primer mixes 2 through 8 for their respective tubes. Proceed to the OpenPCR Program OpenPCR program Step Temperature and Duration Description Initial Step 95 degrees celsius for 2 minutes Prepare for 25 cycles of denaturing, annealing, and extending by adjusting the temperature. Denature 95 degrees celsius for 30 seconds At this high temperature, the double-helix separates into two single strands. Anneal 57 degrees celsius for 30 seconds In this step, primers attach to single strands on the target DNA sequence. The binding of primers to the single strands prevents them from rejoining into a double helix when cooled. Extend 72 degrees celsius for 30 seconds The enzyme Taq polymerase binds to the primers on each strand and extends the complementary strands by adding nucleotides. Final Step 72 degrees celsius for 2 minutes After completion of cycles, adjust the temperature. Final Hold 4 degrees celsius Hold temperature at 4 degrees celsius to keep DNA from replicating. Research and Development PCR - The Underlying Technology Components of a PCR Reaction In order for a PCR to take place template DNA, primers, Taq polymerase, and Deoxyribonucleotides(dNTP's) must be present. Template DNA provides a template for a new strand to be synthesized. Primers keep the single-stranded DNA from rejoining and provide a marker for Taq polymerase to bind and begin to add nucleotides (extend the DNA).Taq polymerase is an enzyme that adds dNTP's to the end of the strand. Thermal Cycling Error creating thumbnail: Unable to save thumbnail to destination For the purpose of this description, please see the image above. A DNA double helix (shown in red), DNA primers (shown in orange), and nucleotides (shown in blue) are in solution. In step one of the OpenPCR program, the red double helix separates into two single strands of DNA when the temperature is increased to 96 degrees Celsius; this step is called denaturing. In step two of the polymerase chain reaction, the orange DNA primers attach to the appropriate ends of the single strands of DNA when the temperature is decreased to 68 degrees; this step is called annealing. In step three of the process, the smallest pieces that make up DNA, the blue nucleotides, are added to the ends of the complementary strands of DNA when the temperature is increased to 72 degrees Celsius; this is called elongation. This process is repeated with the two new double helixes formed from the first cycle. Then repeated with all 4 strands created from the first two cycles. Then repeated with all of the strands from the first three cycles and so on. SNP Information & Primer Design Background: About the Disease SNP A nucleotide is a DNA structure that is composed of three parts: a sugar molecule, a phosphate group, and a nitrogenous base. The phosphate group and the sugar molecule covalently bond to form what is know as the “backbone” of a DNA strand. Thymine, cytosine, adenine, guanine and are the four types nitrogenous bases in DNA. Each one typically bonds with one other (thymine to adenine, and guanine to cytosine) through hydrogen bonds which, as a result, form the double helix structure of DNA. While DNA may be comprised of the same four nucleotides, the sequencing of nucleotides are all different, thus creating a wide variety of gene variation or Polymorphism. Polymorphism is a term used in biology, or genetics more specifically, to describe multiple forms of a single gene that exists in an individual or among a group of individuals. For example ear lobes are an example of polymorphism because it separate its species into two groups, one having open ear lobe; the other having a closed ear lobes. A single nucleotide polymorphism (SNP) is a type of gene variation that occurs most commonly in humans or homo sapiens. The SNP, rs769452, is a single difference in nucleotide that is associated with alzheimer's and subarachnoid hemorrhage in people. This change in nucleotide is classified as pathogenic meaning the diseases associated with it are caused by some virus or microorganism. However, fortunately very few people have developed major health complications as a result of a SNP. Researchers use them more as biological markers in order to prevent a likely disease from taking form should any genes associated with disease be found. Primer Design and Testing An Apolipoprotein E, APOE, is a type of gene that can influence the risk of becoming susceptible to the late-onset type of alzheimer's. There are three types of APOE gene called alleles that can greatly affect the chance of developing the disease. In other words by changing a nucleotide in a codon from a non diseased allele, CTG, then becomes a diseased allele containing the codon CCG. In our assignment we isolated the single nucleotide polymorphism and used its numerical position of 44907853 and designed a non diseased forward primer from one side of the DNA strand. We also had to create a non diseased reverse primer that was essentially the 220 base pairs away on other side of the DNA strand using the matching base pairs. Having the non diseased forward primer as well as the non diseased reverse primer, both were plugged into the genome.uscs.edu website and the result had successfully identified the original chromosome and location that were given at the beginning. Then the diseased codon primer and reverse primer were inserted with the result coming back with no matches due to the mutation not appear naturally in healthy humans. Non-diseased forward primer: AGCGGCCAGCGCTGGGAACT Non-diseased reverse primer: CAGGCCCCCCAAGACTTAGC Disease forward primer: AGCGGCCAGCGCTGGGAACC Disease reverse primer: CAGGCCCCCCAAGACTTAGC Error creating thumbnail: Unable to save thumbnail to destination Error creating thumbnail: Unable to save thumbnail to destination