|
OUR TEAM
LAB 4 WRITE-UP
Protocol
Materials
- Lab coat and disposable gloves
- PCR reaction mix, 8 tubes, 50 mL each: Mix contains Tag DNA polmerase, MgCl2, and dNTP's
(http://www.promega.com/resources/protocols/product-information-sheets/g/gotaq-colorless-master-mix-m714-protocol/)
- DNA/ primer mix , 8 tubes, 50 mL each:Each mix contains a different templarte DNA. All tubes have the same forward primer and reverse primer
- A strip of of empty PCR tubes
- Disposable pipette tips: only use each once. Never reuse dipsosable ipette tips. If you do, the samples will become cross-contaminated.
- Cup for discarded tips
- Micropipettor
- OPenPCR machine: shared by two groups
PCR Reaction Sample List
| Tube Label |
PCR Reaction Sample |
Patient ID
|
| G7 + |
Positive control |
none
|
| G7 - |
Negative control |
none
|
| G7 1-1 |
Patient 1, replicate 1 |
57027
|
| G7 1-2 |
Patient 1, replicate 2 |
57027
|
| G7 1-3 |
Patient 1, replicate 3 |
57027
|
| G7 2-1 |
Patient 2, replicate 1 |
97392
|
| G7 2-2 |
Patient 2, replicate 2 |
97392
|
| G7 2-3 |
Patient 2, replicate 3 |
97392
|
DNA Sample Set-up Procedure
- Step 1: drag the extracted DNA to the PCR tube
- Step 2: Add primer 1 to the PCR tube
- Step 3: Add Primer 2 to the PCR tube
- Step 4: Add nucleotides to the PCR tube
- Step 5: Add DNA polymerase to the PCR tube
- Step 6: Place the PCR tube in the DNA Thermalcycler
- Step 7: Start the Thermacycler
OpenPCR program
HEATED LID: 100°C
INITIAL STEP: 95°C for 2 minutes
NUMBER OF CYCLES: 25
Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds
Extend at 72°C for 30 seconds
FINAL STEP: 72°C for 2 minutes
FINAL HOLD: 4°C
Research and Development
PCR - The Underlying Technology
Q1. What is the function of each component of a PCR reaction?
| Template DNA: |
The DNA template contains the target sequence of DNA. It is used as the base strand that all further DNA is synthesized from.
|
| Primers: |
The primers are short pieces of DNA that are complementary to the target DNA sequence or the template DNA. They allow the polymerase to synthesize new DNA strands.
|
| Taq Polymerase: |
This polymerase synthesizes new DNA strands from the primers that are complementary to the DNA strand it is being synthesized from.
|
| Deoxyribonucleotides(dNTP’s): |
These are nucleotides which are the building blocks of the DNA strands.
|
Q2. What happens to the components (listed above) during each step of thermal cycling?
| INITIAL STEP: 95°C for 3 minutes: |
The double stranded DNA unfurls and becomes less stable in preparation for its denaturing.
|
| Denature at 95°C for 30 seconds: |
The double stranded DNA splits into two seperate strands which new DNA can be synthesized form.
|
| Anneal at 57°C for 30 seconds: |
The primers force their way to bind to their base pairs in split DNA strands.
|
| Extend at 72°C for 30 seconds: |
This activates DNA polymerase and causes it to bind to the primers attached to DNA single strands.
|
| FINAL STEP: 72°C for 3 minutes: |
The DNA polymerase creates nucleotides along the DNA creating more base pairings, creating a new double stranded DNA.
|
| FINAL HOLD: 4°C: |
At this temperature the reaction can be stored for a short time.
|
Q3. DNA is made up of four types of molecules called nucleotides, designated as A, T, C and G.
Base-pairing, driven by hydrogen bonding, allows base pairs to stick together. Which base anneals to
each base listed below?
| Adenine (A):
|
Thymine (T)
|
Thymine (T):
|
Adenine (A)
|
Cytosine (C):
|
Guanine (G)
|
Guanine (G):
|
Cytosine (C)
|
Q4. During which two steps of thermal cycling does base-pairing occur? Explain your answers.
When it anneals at 57 degrees celsius the primers find their base-pairs on DNA single strands and bind to them. Then at the final step of 72 degrees celsius the DNA polymerase creates nucleotides which are base-pairs of the the DNA strand.
Background: About the Disease SNP
| What is a nucleotide? |
a compound consisting of a nucleotide linked to a phosphate group. Nucleotides form the basic structural unit of nucleic acid such as DNA
|
| What is a polymorphism? |
a common variation in the sequence of DNA among individuals. Genetic variations occurring in more than 1% of the population would be considered useful polymorphism for genetic linkage analysis.
|
| What species is this variation found in? (latin name) |
homosapiens
|
| What chromosome is the variation located on? |
4
|
| What is listed as the Clinical significance of this SNP? |
pathogenic allele
|
| What condition is linked to this SNP? |
a cardiac arrhythmia syndrome caused by loss of ankyrin-B function
|
| What does ANK2 stand for? |
ankyrin 2, neuronal
|
| What is the function of ANK2? To find out, click the ANK2 link. Under Table of Contents (right side) click Gene ontology. Write the first three unique terms you see. |
ATPase binding, cytoskeletal adaptor activity, enzyme binding
|
| What is an allele? |
one of the two or more alternative forms of a gene that arise by mutation and are found at the same place on a chromosome
|
| The disease-associated allele contains what codon? |
CTC→ATC
|
| The numerical position of the SNP is: |
113367751
|
| Non-disease forward primer (20 nt): |
5' GGACAGCTCAGCAACAGCAC 3'
|
| The numerical position exactly 200 bases to the right of the disease SNP is: |
113367951
|
| Non-disease reverse primer (20 nt): |
5' TAAAAAGTATTTAAAAACTA 3'
|
| Disease forward primer (20 nt): |
5' GGACAGCTCAGCAACAGCAG 3'
|
| Disease reverse primer (20 nt): |
5' TAAAAAGTATTTAAAAACTA 3'
|
Primer Design and Testing
Based on the results of the primer test it can be concluded that the non disease primer indicated a 220bp sequence on the 4 chromosome. The disease primer resulted in no match.
Non-Disease Primer Results:
Disease Primer Results:
|