BME100 f2016:Group5 W8AM L4
BME 100 Fall 2016 | Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||
OUR TEAMLAB 4 WRITE-UPProtocolMaterials
OpenPCR program HEATED LID: 100°C INITIAL STEP: 95°C for 2 minutes NUMBER OF CYCLES: 25 Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and Extend at 72°C for 30 seconds FINAL STEP: 72°C for 2 minutes FINAL HOLD: 4°C
Research and DevelopmentPCR - The Underlying Technology Function of PCR DNA template is the DNA that is being copied for replication. Primers are specifically designed to attach to the DNA and will bind to the DNA polymerase. The Taq polymerase adds the corresponding Deoxyribonucleotide to the DNA. The dNTP's are the components that compose DNA. Thermo Cycling When heated to 95C in the initial and denature steo, the DNA will denature by untwisting and splitting into to separate strands. At 57C in the anneal step, the primers attach to the separate strands. At 72C in the extend and final step, the taq polymerase will bind to the primer and add the corresponding nucleotides to the DNA. At 4C in the hold phase, the DNA strands will return to their double helix shape. Base Pairing Adenine and Thymine pair together while Guanine and Cytosine pair together. Cycle Base Pairing When the thermos cycler is at 72C, the Extend and Final step, the polymerase is bonded to the primer on the DNA strand which allows the polymerase to match the nucleotides to their counterparts.
SNP Information & Primer DesignNucleotides are the monomers that compose nucleic acids. Polymorphism is when there are two or more different forms of a subject that belong to the same habitat. Background: About the Disease SNP SNP rs35530544 specie is a homo sapien with a variation located on chromosome 4:113367751. The clinical significance is that the DNA variation was shown to be pathogenic. This particular SSNP is associated with a cardiac arrhythmia syndrome caused by loss of ankyrin-B function. ANK2 stands for Ankyrin-B. ANK2 functions include ATPase binding, cytoskeletal adaptor activity, and enzyme binding. An allele is the different way a gene can be formed by mutation on a chromosome. The non-disease codon of CTC is changed into the disease codon of ATC. The position is 113367751. non-disease forward primer 5' GGACAGCTCAGCAACAGCAC 3' The non-disease reverse primer is at 113367951. non-disease reverse primer 5' TAAAAAGTATTTAAAAACTA 3' disease forward primer (SNP) 5' GGACAGCTCAGCAACAGCAA 3' disease reverse primer 5' TAAAAAGTATTTAAAAACTA 3' Primer Design and Testing
|