BME100 f2016:Group4 W8AM L4

BME 100 Fall 2016	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Error creating thumbnail: File missing Name: Manyta Parmar Role(s) Error creating thumbnail: File missing Name: Nathalie Nunez Role(s) Name: Mark McPherson Role(s) Name: Danielle Morelan Role(s) Error creating thumbnail: File missing Name: Shannon Medovich Role(s) LAB 4 WRITE-UP Protocol Materials Lab Coat PCR reaction mix, 8 tubes, 50 μL each: Mix contains Taq DNA polymerase, MgCl 2, and dNTP’s DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer A strip of empty PCR tubes Disposable pipette tips: only use each only once. Never reuse disposable pipette tips . If you do, the samples will become cross-contaminated Cup for discarded tips Micropipettor OpenPCR machine: shared by two groups PCR Reaction Sample List Tube Label PCR Reaction Sample Patient ID G# + Positive control none G# - Negative control none G# 1-1 Patient 1, replicate 1 18158 G# 1-2 Patient 1, replicate 2 18158 G# 1-3 Patient 1, replicate 3 18158 G# 2-1 Patient 2, replicate 1 76712 G# 2-2 Patient 2, replicate 2 76712 G# 2-3 Patient 2, replicate 3 76712 DNA Sample Set-up Procedure Step 1 Step 2 Step 3... OpenPCR program Heated Lid: 100°C Initial Step: 95°C for 2 minutes Number of Cycles: 25 Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and Extend at 72°C for 30 seconds* Final Step: 72°C for 2 minutes Final Hold: 4°C INITIAL STEP: 95℃ for 3 minutes: The DNA is heated Denature at 95℃ for 3 minutes: The DNA double helix separates, creating two single stranded DNA molecules Anneal​ at 57°C for 30 seconds: Primers bind to complementary matches to DNA sequences Extend​ at 72°C for 30 seconds: DNA polymerase locates a primer on the DNA strand and begins to add complementary nucleotides FINAL STEP: 72°C for 3 minutes: DNA polymerase continues until it gets to the end of the strand and falls off FINAL HOLD: 4°C: DNA polymerase is limited so that non-specific binding of primers and amplification of the sites is prevented Research and Development PCR - The Underlying Technology Summary: SNP is a disease that there is still controversy on whether it is pathogenic or benign. However, most research shows that it is indeed benign. The disease comes in the form of cardiac arrhythmia or Long QT Syndrome. This variation is found in humans only (Homo sapienss). SNP affects the human genome that it affects is chromosome 4. Template DNA The strand of DNA acts as template to be copied into mRNA and then translated Primers Attach to sites on a DNA strand that are at either end of the segment that you want to copy TAQ Polymerase Copy a cell’s DNA before it divides Deoxyribonucleotides(dNTP’s):​ Supports the replication of mitochondrial DNA Question 3: Which base anneals to which? Adenine (A):T Thymine (T):A Cytosine (C):G Guanine (G):C Question 4: During which two steps of thermal cycling does base-pairing occur? Base pairing occurs during extension at 72°C for 30 seconds and the final step at 72°C for 3 minutes. During extension DNA polymerase begins to add the nucleotides after binding to the primer on the DNA strand. During the final step, DNA polymerase finishes adding nucleotides until reaching the end of the strand. SNP Information & Primer Design Background: About the Disease SNP What is a nucleotide? Compound that has a nucleoside and a phosphate group. (form the basic structural unit of nucleic acids such as DNA) What is a polymorphism? A gene is polymorphic if more than one allele occupies that gene’s locus within a population. (Ex: In dogs the E locus controls coat pattern and there are 5 different types of alleles) What species is this variation found in? (latin name) Homo sapiens What chromosome is the variation located on?​ Chromosome 4 What is listed as the clinical significance of of this SNP? Pathogenic (1) / Benign (3) Controversy What condition is linked to this SNP? Cardiac arrhythmia, Long QT Syndrome, Cardiovascular Phenotype What does ANK2 stand for? Ankyrin 2, neuronal What is the function of ANK2? Cell motility, activation, and proliferation What is an allele? Alternative form of a gene that occur by mutation but are found at the same place on a chromosome. The disease-associated allele contains what codon? C The numerical position of the SNP​ is: 113367751 Primer Design and Testing Non-disease forward primer (20 nt): 5’ GGACAGCTCAGCAACAGCAC The numerical position exactly 200 bases to the right of the disease SNP​ is: 113367951 Non-disease reverse primer (20 nt): 5’ CCTGTCGAGTCGTTGTCGTG Disease forward primer (20 nt): 5’ GGACAGCTCAGCAACAGCAA Disease reverse primer (20 nt): 5’ CCTGTCGAGTCGTTGTCGTT Summary: The primer that does not result in having the disease has a nucleotide of C. The nucleotide is located at 113367751. For the disease to be present, the primer will have a nucleotide of A instead of C. This results in the reverse primer having a nucleotide of T instead of G.