|
OUR TEAM
LAB 4 WRITE-UP
Protocol
Materials
- Lab coat
- Disposable globes
- PCR reaction mix- 8 tubes, 50 μL each (contains Taq DNA polymerase, MgCl2, and dNTP's)
- DNA/ primer mix- 8 tubes, 50 μL each (contains a different template DNA per tube but same forward and reverse primers)
- Strip of empty PCR tubes
- Disposable pipette tips
- Cup for used pipette tips
- Micropipettor
- OpenPCR machine
PCR Reaction Sample List
| Tube Label |
PCR Reaction Sample |
Patient ID
|
| G12 P |
Positive control |
none
|
| G12 N |
Negative control |
none
|
| G12 1-1 |
Patient 1, replicate 1 |
37106
|
| G12 1-2 |
Patient 1, replicate 2 |
37106
|
| G12 1-3 |
Patient 1, replicate 3 |
37106
|
| G12 2-1 |
Patient 2, replicate 1 |
54597
|
| G12 2-2 |
Patient 2, replicate 2 |
54597
|
| G12 2-3 |
Patient 2, replicate 3 |
54597
|
DNA Sample Set-up Procedure
- Place extracted DNA in an empty PCR tube using the micropipettor
- Dispose of the pipette tip and replace with new pipette tip
- Add both primer 1 and primer 2 to the PCR tube using the micropipettor
- Dispose of the pipette tip and replace with new pipette tip
- Add nucleotides to the PCR tube using the micropipettor
- Dispose of the pipette tip and replace with new pipette tip
- Add Taq DNA polymerase to the PCR tube using the micropipettor
- Dispose of the pipette tip
- Place PCR tube in the thermal cycler
- Repeat for three trials of both patients
OpenPCR program
We will start by heating the PCR machine to 100°C. High temperatures are needed to achieve denaturation of DNA, so we'll start at 100°C. The reason we use TAQ polymerase is because it comes from bacteria that live in hot springs. This allows the TAQ proteins to not denature, even when the DNA does. During the annealing step, we lower the temperature to 57°C, which is low enough of a temperature for the primers to adhere (anneal) to the DNA. Finally, in the extension step, the TAQ polymerase adds nucleotide base pairs to the DNA strand, amplifying the specific section of DNA we're interested it. This cycle is repeated 25 times. So, to simplify the process:
HEATED LID: 100°C
INITIAL STEP: 95°C for 2 minutes
NUMBER OF CYCLES: 25
- Denature at 95°C for 30 seconds
- Anneal at 57°C for 30 seconds
- Extend at 72°C for 30 seconds
FINAL STEP: 72°C for 2 minutes
FINAL HOLD: 4°C
Research and Development
PCR - The Underlying Technology
Error creating thumbnail: File missing
S, M. (2014, October 3). Principle of PCR and applications. Retrieved October 12, 2016, from http://www.slideshare.net/MetheeSri/principle-of-pcr
Error creating thumbnail: File missing
Brent Cornell. (n.d.). Retrieved October 12, 2016, from http://ib.bioninja.com.au/standard-level/topic-3-genetics/35-genetic-modification-and/pcr.html
Functions of Components2 - In the Polymerase Chain Reaction, the template DNA is the strand of DNA where the PCR takes place and replicates a desired gene. The primers attach to either end of the template DNA after it has been separated, and completes a reconstruction of the desired gene that it is attached to. After that, the Taq Polymerase reacts at various temperatures, separating at 95°C, allows the primers to attach at 50°C, and then the Tap becomes active at 72°C. During PCR, deoxyribonucleotides (dNTP's) are found and attached to the strands of DNA in order to create the replicated strand of DNA, allowing it to replicate.
Steps of Thermal Cycling1 - At the beginning of thermal cycling, when the temperature sits at 95°C for around 3 minutes, the double helix of the DNA begins to unwind. Upon reaching a certain point, the DNA begins to denature where it fully unwinds and separates into single strands of DNA for 30 seconds. The DNA is annealed to 57°C for 30 seconds, where the primers lock onto either end of the desired gene before the DNA is able to reattach. After that, the temperature is raised slightly to 72°C for about 30 seconds where the DNA polymerase extends and forms other strands of the gene. The final step lasts for about 3 minutes at 72°C, and it is when the polymerase finishes replicating the strands of DNA and detaches. The final hold, which is at 4°C, is when the newly made genes are formed and a nearly full solution of the gene is formed.
Nucleotide Base Pairs - In the DNA Sequence, Adenine(A) attaches to Thymine(T) and Cytosine(C) attaches to Guanine(G).
When does Base Pairing Occurs? - In PCR, base pairing occurs at 50°C when the primers attach to the DNA based on its base pairs. The primers search, at attach to the ends of the gene using its base pairs, and is only able attach to that section fo the DNA. It also occurs at 72°C when the DNA polymerase extends and forms the remaining base pairs for the DNA sequence in order to replicate the gene of interest. The polymerase continues along the strands of DNA in order to create the corresponding base pairs in order to replicate the DNA strands.
1PCR. (n.d.). Retrieved October 12, 2016, from http://learn.genetics.utah.edu/content/labs/pcr/
2Taq polymerase. (n.d.). Retrieved October 12, 2016, from https://en.wikipedia.org/wiki/Taq_polymerase
Background: About the Disease SNP
The disease SNP is one that affects humans (Homo sapiens) and it appears on the fourth chromosome (https://www.ncbi.nlm.nih.gov/snp/?term=rs35530544). A single nucleotide polymorphism occurs when one base is varied in the genome and effects the expression of the gene. Its position is 113,367,751. The SNP has disputed pathogenicity, with three cases being benign and one being pathogenic. In the pathogenic case, the SNP causes either cardiac arrhythmia or Long QT syndrome. The cardiac arrhythmia is caused by the loss of ankryin-B function. It appears that 215 of 5337 people have the SNP, or about 4% of the population (https://www.ncbi.nlm.nih.gov/clinvar/variation/18058/#clinical-assertions).
To find the correct primers, the position 113,367,751 was located and the 19 base pairs before the mutated base pair makes up the forward primer. To complete the reverse primer, we moved 200 base pairs to the left and and recored the last 20 base pairs of the sequence. The DNA snippet contains 220 base pairs and is on chromosome 4. In order to create the disease primer, only one base pair was changed: the one in position 113,367,751 was changed from a C to an A. This will create the disease-associated allele with the codon ATC instead of CTC. An allele is an alternate form of a gene that arrises from a mutation.
Non-disease forward primer: GGACAGCTCAGCAACAGCAC
Non-disease reverse primer: TAAAAAGTATTTAAAAACTA
Disease forward primer:GGACAGCTCAGCAACAGCAA
Disease reverse primer: TAAAAAGTATTTAAAAACTA
Primer Design and Testing
When the primer was tested using the non-disease forward and reverse primers, the result that was produced was from the same chromosome (chromosome 4) as the found in the database of short genetic variations. It was also the same number of base pairs (220) as was found on the database of short genetic variations.
Error creating thumbnail: File missing
To find the disease specific primers, only one base pair on the forward primer was changed because this related to the primer needed for the disease. When the disease-specific primers were inputted, there was no result. This is because the human genome doesn't contain the sequence that contains the disease. It is an abnormal DNA sequence and will not be recognized by the database that contains a non-disease human genome sequence.
Error creating thumbnail: File missing
|