BME100 f2016:Group11 W8AM L4

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png BME 100 Fall 2016 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help
BME494 Asu logo.png


OUR TEAM

Name: Elmer Correa
Name: Isaac Alemu
Name: Erik Ireland
Name: Maria Predtechenskaya
Name: Zach Mizera

LAB 4 WRITE-UP

Bold text==Protocol==

Materials

  • Lab coat
  • Disposable gloves
  • PCR reaction mix (8 tubes, 50 μL each): contains Taq DNA polymerase, MgCl2, and dNTP's (http://www.promega.com/resources/protocols/product-information-sheets/g/gotaq-colorless-master-mix-m714-protocol/)
  • DNA/primer mix (8 tubes, 50 μL each): each mix contains a different template DNA. All tubes have the same forward and reverse primer
  • Strip of empty PCR tubes
  • Disposable pipette tips: only use each only once! Don't reuse pipette tips to avoid cross-contamination!
  • Cup for discarded tips
  • Micropipettor
  • OpenPCR machine: shared by two groups


PCR Reaction Sample List

Tube Label PCR Reaction Sample Patient ID
G11 + Positive control none
G11 - Negative control none
G11 1-1 Patient 1, replicate 1 56439
G11 1-2 Patient 1, replicate 2 56439
G11 1-3 Patient 1, replicate 3 56439
G11 2-1 Patient 2, replicate 1 58174
G11 2-2 Patient 2, replicate 2 58174
G11 2-3 Patient 2, replicate 3 58174


DNA Sample Set-up Procedure

  1. Step 1: Open a tube and with a micropipette, insert 50 μL of the DNA and primer mix into an empty PCR tube.
  2. Step 2: Discard the pipette tip into the cup and attach a new one.
  3. Step 3: Take 50 μL of the PCR reaction mix into the PCR tube that already contains the 50 μL of the DNA and primer mix.
  4. Step 4: Discard the pipette tip into the cup and attach a new one.
  5. Step 5: Close the lid of the PCR tube and label it with the Tube Label from above.
  6. Step 6: Repeat step 1 to step 5 for all of the test tubes with patient DNA.
  7. Step 7: Place all the tubes into the thermal cycler.


OpenPCR program



Instructions.PNG


To describe the steps above, keeping the temperature at 95°C makes the double helix DNA unzip itself, resulting in two strands. Once the temperature is lowered to 57°C, the primers attach, each to their respective location on each of the separate strands. One primer marks the beginning of the DNA that needs to be copied, the other primer is is at the end of the sequence that needs to be copied. At 72°C, the Taq DNA Polymerase attaches and starts attaching nucleotide bases based on the DNA code it is copying. Next, the temperature is increased to 95°C again so that the Polymerase breaks apart and the new sequences are again unzipped to be recopied. This cycle of steps is repeated 25 times so that a lot of copied strands of the desired sequence is emerged and scientists can then use the sequence to test it further.

Image Source:BME 100 Lab Workbook, Online

Research and Development

PCR - The Underlying Technology

Q1-What is the function of each component of a PCR reaction?

The template DNA is the DNA being tested in the first place for a particular sequence within it. It will be denatured during the first step of the thermal cycling for detection of that particular sequence. Primers are short sequences of nucleotide, synthesized to bind, or anneal, to either end of the target sequence being replicated. Taq Polymerase is a protein which can function at high temperature that attaches to the complementary primers and extends a second strand of DNA, building nucleotides, off it as a base. Deoxyribonucleotides are constituent components of DNA which function as the "code" which is replicated with the taq polymerase to replicate the target sequence.




Q2-What happens to the components (listed above) during each step of thermal cycling?

The initial step is to hold the mixture at 95 degrees Celsius for 3 minutes.During this step, the template DNA sample mixture is cleared of any contaminants by the high temperatures in order to ensure and prepare the PCR process for maximum efficiency. Next the template DNA denatures at 95°C for 30 seconds with the double-helix structure of the DNA separated into two strands as a result of the high temperatures. Annealing then occurs at 57°C for 30 seconds. During this point of the process, two short strands of DNA called primers anneal to their complementary matches on the separated DNA, on either end of the target DNA sequence that is to be replicated. The mixture is then extended at 72°C for 30 seconds where Taq polymerase binds to the primers and, using it as a starting point, forms nucleotide to further extend a newly formed second strand which comes out to be the target sequence. After the thermal cycling has been completed to satisfaction, the mixture is held at 72°C for 3 minutes. The purpose of this step is to extend any remaining primers missed by taq polymerase in previous thermal cycles to totally complete the process. Finally the the mixture is held at 4°C to prevent remaining DNA from replicating more and keep the result of the processes in a stable state for storing.


Q3: DNA is made up of four types of molecules called nucleotides, designated as A, T, C and G. Base-pairing, driven by hydrogen bonding, allows base pairs to stick together. Which base anneals to each base listed above?

Adenine binds to Thymine with the reverse holding true and Cytosine binds to Guanine and vice-versa.


Q4: During which two steps of thermal cycling does base-pairing occur? Explain your answers. Base pairing occurs during the third and fourth steps, when annealing of primers and taq polymerase takes place receptively. In the former step, primers bind to separated strands of DNA and so base pairing must occur to bind the primers to that DNA. Taq polymerase in the fourth step extends nucleotides off those primers, extends a second strand of DNA and inevitably having to create a sequence of complementary nucleotides to bind onto the existing DNA strand.




PCRIllustrationblahblahblah.gif


References:

Illustration of the PCR process. (2007, June 15). Retrieved October 17, 2016, from https://www2.le.ac.uk/departments/emfpu/genetics/explained/images/PCR-process.gif/view




SNP Information & Primer Design

Background: About the Disease SNP SNP stands for "single nucleotide polymorphism." A nucleotide is a structural element of DNA and RNA. It consists of a base such as A, T, C, or G and a sugar with a phosphate. The polymorphism part means that there is genetic variation among the members of a community which leads to natural selection and survival of the fittest. The SNP variation is found in homo sapiens, which means humans. The chromosome that this change is found in is: 4:113367751. It is clinically significant, because it has a pathogenic allele. This change causes the cardiac arrhythmia syndrome, according to the citations. This SNP produces the protein, ANK2, which stands for ankyrin 2. Examples of the function of this protein are ATPase binding which is the selective interaction with an ATPase which itself is an enzyme that is a catalyst for the hydrolysis ATP. Another function is in its role in the binding of a particular molecule that allows the coordination of a cytoskeletal protein and one or more other molecules. ANK2 also plays an active part in enzyme binding where it non-covalently with any enzyme. An allele is one or more alternative forms of a gene that arises by mutation and are found on the same place on a chromosome. The disease associated allele for this nucleotide sequence contains the codon ATC instead of the 'correct' CTC codon. The numerical position of the SNP is 113367751.


Primer Design and Testing The non-disease forward primer is: 5'- GGACAGCTCAGCAACAGCAC - 3' The numerical position exactly 200 bases to the right of the disease SNP is: 113367951 (the previous position was 113367751). This is done to include the gene segment that we want to PCR. The non-disease reverse primer is: 5'- TAAAAAGTATTTAAAAACTA - 3'

The primers that are specific to the SNP disease are below: The disease forward primer: 5'- GGACAGCTCAGCAACAGCAA - 3' Because in the SNP disease the part of the codon that is changed from normal A to C, in the primer that attaches to the following disease part also must be changed to C. Everything else is unchanged. The disease reverse primer: 5'- TAAAAAGTATTTAAAAACTA - 3'



Validation:

Non-disease primer result:

Non-disease-result.PNG


Disease (SNP) primer result:

Disease-snp-result.PNG


References: (both images were taken from the same source)

Kent, J. (2009). USCS In-Silico PCR. USCS Genome Bioinformatics. Retrieved from http://genome.ucsc.edu/cgi-bin/hgPcr?command=start.


The reason why the SNP primer is not in the database is because we are not looking up the normal DNA sequence (that showed up). We are looking up one of the polymorphisms. In other words, we are looking for a primer that is specific to one possible variation in the nucleotide out of 2 others. The 3 base variations are not normal; only 1 is the normal base that usually shows up in a majority of people before it is altered in a point mutation.