|
OUR TEAM
LAB 4 WRITE-UP
Protocol
Materials
- Lab coat and disposable gloves
- PCR reaction mix, 8 tubes, 50 µL each: Mix contains Taq DNA polymerase, MgCl2, and dNTP’s
- DNA/ primer mix, 8 tubes, 50 µL each: Each mix contains a different template DNA. All tubes
have the same forward primer and reverse primer
- A strip of empty PCR tubes
- Disposable pipette tips
- Cup for discarded tips
- Micropipettor
- OpenPCR machine
PCR Reaction Sample List
| Tube Label |
PCR Reaction Sample |
Patient ID
|
| G10 + |
Positive control |
none
|
| G10 - |
Negative control |
none
|
| G10 1-1 |
Patient 1, replicate 1 |
77434
|
| G10 1-2 |
Patient 1, replicate 2 |
77434
|
| G10 1-3 |
Patient 1, replicate 3 |
77434
|
| G10 2-1 |
Patient 2, replicate 1 |
77218
|
| G10 2-2 |
Patient 2, replicate 2 |
77218
|
| G10 2-3 |
Patient 2, replicate 3 |
77218
|
DNA Sample Set-up Procedure
During the first step of the procedure, we will start with a DNA sample from a patient via skin cells, saliva or a hair follicle. DNA is extracted from the source and put into the PCR test tube with a micropipette.
The next step would be to add Primer 1 and Primer 2 to the PCR tube with the extracted DNA in it. This is done with a micropipette.
Lastly, the final step will be to add free nucleotides and DNA polymerase, which comes from a thermophilic bacteria to the PCR test tube. This is also done with a micropipette.
OpenPCR program
HEATED LID: 100°C
INITIAL STEP: 95°C for 2 minutes
NUMBER OF CYCLES: 25
- Denature at 95°C for 30 seconds
- Anneal at 57°C for 30 seconds
- Extend at 72°C for 30 seconds
FINAL STEP: 72°C for 2 minutes
FINAL HOLD: 4°C
Work Cited
BME 100 Lab WorkBook: DNA Labs. (n.d.). Retrieved October 12, 2016, from
https://myasucourses.asu.edu/bbcswebdav/pid-13760008-dt-content-rid-85888200_1/courses/2016Fall-T-BME100-80310-80311/BME100LabWorkbookDNALabs-Fall2016.pdf
Research and Development
PCR - The Underlying Technology
Components of a PCR Reaction
Template DNA is a small sample of DNA from hair, blood, saliva, etc. and is the strand of DNA where the PCR reaction takes place and replicates the desired genes. Primers copy specific DNA sequences and are attached to sites on the template DNA strands at either end of the segment that an experimenter wishes to copy. Taq polymerase acts like a tiny machine that reads DNA code. It locates a primer that is attached to a single DNA strand and begins attaching complementary nucleotides to create DNA copies. Deoxyribonucleotides (dNTP's) are nucleotides that are created from the PCR reaction due to the Taq polymerase attaching these complementary nucleotides to the DNA strand.
Components During Each Step of Thermal Cycling
Initial Step 95 degrees C for 3 minutes-The DNA double helix bonds break at this temperature.
Denature at 95 Degrees for 30 seconds-The Template DNA strands pull apart, forming two complete separate strands.
Anneal at 57 Degrees for 30 seconds-The DNA polymerase is activated and the DNA molecules attempt to pair up.
DNA becomes crowded due to more primer than DNA and are forced onto strands.
Extended at 72 Degrees for 30 seconds-DNA Polymerase locates a primer attached to a single DNA strand, and begins to add complimentary nucleatoids onto the strand.
Final Step at 72 degrees for 3 minutes'- Complimentary nucleatoids continues bonding until it reached the end of the strand and falls off.
Nucleotide Base Pairs
In DNA sequencing, Adenine(A) attaches to Thymine(T) (and vice versa) and Cytosine(C) attaches to Guanine(G) (and vice versa).
Thermal Cycling Base-Pairing
At 50 degrees Celsius the primers base pair to the separated strands of DNA at the targeted sites. Then at 72 degrees Celsius the DNA Polymerase will pick up free floating nucleotides in the solution and base pair them to the DNA strand to complete the double helix. These are the Annealing and Extending steps of thermal cycling.
Work Cited
PCR. (2008). Retrieved October 12, 2016, from
http://learn.genetics.utah.edu/content/labs/pcr/
Background: About the Disease SNP
The disease variation SNP is found in the species of Homo Sapiens and is located on chromosome 4 of the genome. The clinical significance is with the pathogenic allele, suggesting that it causes disease . The main condition linked with this variation is cardiac arrhythmia, which is caused by a loss of ankyrin-B function and referred to as type 4 long QT syndrome in the beginning stages. GeneView analysis examnines ANK2, formally known as ankyrin 2. Functions of the ANK2 include cell motility, activation, proliferation, and the contact and maintenance of specialized membrane domains. The disease- associated allele (the alternate form of the same gene that causes the disease) contains the codon
ATC, while the non-disease was CTC. The change in the allele at the C position is specifically linked to the condition at hand and the numerical position of the SNP is 113367751.
Primer Design and Testing
The National Center for Biotechnology website was used as a reference for this portion of the lab. The Single Nucleotide Polymorphism that was of interest in this case was labeled as rs35530544 and is a missense in the genetic sequence causing clinical pathology. The numerical position of this SNP was recorded and the forward 5’ sequence was copied from the SNP position to 20 nucleotides to the right. The diseased nucleotide was replaced with the non-diseased version to create our Non-Diseased Forward Primer. Jumping over 200 base positions to the right, we followed the same process starting on the reverse 3’ strand and recorded 20 nucleotides over. This became our Non-Disease Reverse Primer. On the UCSC In-Silico PCR website, we tested both our non-disease primers in the genome database and they worked with 220 base-pair sequences on our targeted chromosome.
Non-disease reverse primer: 5' TAAAAAGTATTTAAAAACTA 3'
Non-disease forward primer: 5' GGACAGTCAGCAACAGCAA 3'
Disease reverse primer: 5' AAAAGTATTTAAAAACTAGT 3'
Disease forward primer: 5' GGACAGCTCAGCAACAGCAC 3'
Number position 200 bases to right: 113367950
Error creating thumbnail: File missing
Work Cited
DbSNP Short Genetic Variations. (n.d.). Retrieved October 12, 2016, from
https://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=35530544
| 
BME 100 Fall 2016
