BME100 f2014:Group9 L5

BME 100 Fall 2014	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Error creating thumbnail: File missing Kevin Koza Error creating thumbnail: File missing Evan Targioni Error creating thumbnail: File missing Logan Murphy Error creating thumbnail: File missing Phil Liles Error creating thumbnail: File missing Cameron Hiller Error creating thumbnail: File missing Tiffany Gong LAB 5 WRITE-UP Procedure Smart Phone Camera Settings Type of Smartphone: Moto G Flash: Off ISO setting: Highest setting White Balance: Auto Exposure: High Saturation: High Contrast: Low Calibration The phone was set in the cradle with the camera facing the side of the drop at a slight downward angle to center the photograph. Distance between the smart phone cradle and drop = 11cm Solutions Used for Calibration Initial Concentration of 2X Calf Thymus DNA Solution (micrograms/mL) Volume of the 2X DNA Solution Volume of SYBR Green I Final DNA Concentration 5 80 80 2.5 2 80 80 1 1 80 80 .5 0.5 80 80 .25 0.25 80 80 .125 0 80 80 0 Placing Samples onto the Fluorimeter Once all sample solutions are procured, align the cradle and smartphone into an optimal position for taking photos from the side of the fluorimeter. Place 80 microliters of SYBR Green I and 80 microliters of the sample solution on the superhydrophobic side of a slide, between two of the glass dots. Align the slide so that the drop is illuminated by the blue light. Take three photos of the drop with the smartphone, and then remove the drop. Repeat this process with each different sample solution, moving to a different section of the superhydrophobic slide each time. Data Analysis Representative Images of Negative and Positive Samples Image J Values for All Calibrator Samples Error creating thumbnail: File missing Calibration curve Error creating thumbnail: File missing PCR Results Summary Our positive control PCR result was 2.36 μg/mL Our negative control PCR result was -.81 μg/mL* * Negative results may occur from error in the best-fit line Observed results Patient 19405 : -.27 μg/mL.* The images showed no green fluorescence. Patient 26455 : -.41 μg/mL.* The images showed no green fluorescence. Conclusions Patient 19405 : Negative. The concentration of DNA is similar to that of the negative control, and since no green fluorescence was observed, it signifies that the patient does not possess the diseased DNA. Patient 26455 : Negative. The concentration of DNA is similar to that of the negative control, and since no green fluorescence was observed, it signifies that the patient does not possess the diseased DNA. SNP Information & Primer Design Background: About the Disease SNP The disease SNP studied in this lab was categorized as rs16991654. It is a SNP found in the species homo sapiens, found in the chromosome 21:34370656. The clinical significance of this SNP is pathogenic, and it is associated with the KCNE2 gene, which has association with long QT syndrome, a rare heart condition. KCNE2 stands for potassium voltage-gated channel, Isk-related family, member 2. The function of this gene is to create a channel which functions in neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. It assembles with the product of another gene, which is a pore-creating protein, to alter its function. Primer Design and Testing In our primer test, we learned that the disease-associated allele contained the sequence CTC, and that the non-disease sequence was TTC. We used this information to find the forward primer for the non-disease sequence, which was TGGTGATGATTGGAATGTTC. 200 units from this was the reverse primer, which was CTCCCTTATCAGGGGGACAT. The disease forward primer was TGGTGATGATTGGAATGCTC, and the reverse primer was CTCCCTTATCAGGGGGACAT. These primers were taken to http://genome.ucsc.edu/cgi-bin/hgPcr?command=start, where we ran them through the program to determine the result. The non-disease primers finished with the result as follows: Error creating thumbnail: File missing This validates our results in finding the correct primers, and when the test is run with the disease primers, no results are found.