|
OUR TEAM
Group #7
LAB 5 WRITE UP
Procedure
Camera Settings
- No flash
- We did not change any other camera settings for this lab
| Smartphone 1: Model |
Optional Smartphone 2: Model
|
| iPhone 5c |
iPhone 5
|
Calibration
- Turn on the blue LED excitation light with the switch.
- Turn on the camera of the smart phone and check the settings of the camera on the smart phone.
- Place the smart phone on the cradle at a right angle from the slide.
- Adjust the height of the fluorimeter using the plastic trays so that the camera takes a picture of the drop sideways.
- Adjust the distance between the smartphone on its cradle and the first two rows of the slide so that it is as close as possible without making the image blurry. It should be at least 4 cm away from the drop.
- Record the distance between the smart phone cradle and drop using a ruler. Be careful not to move the fluorimeter, camera, or cradle too much.
| Distance in cm (centimeters): |
4 cm
|
Solutions We Used for Calibration
| Initial Concentration of 2X Calf Thymus DNA solution (micrograms/mL) |
Volume of the 2X DNA solution (µL) |
Volume of the SYBR GREEN I Dye solution (µL) |
Final DNA concentration in SYBR Green I solution (µg/mL)
|
| 5 |
80* |
80* |
2.5
|
| 2 |
80* |
80* |
1
|
| 1 |
80* |
80* |
0.5
|
| 0.5 |
80* |
80* |
0.25
|
| 0.25 |
80* |
80* |
0.125
|
| 0 |
80* |
80* |
0
|
Placing Samples Onto the Fluorimeter
- Place a 80* microliter drop of SYBR GREEN I in the middle of the first two rows of the slide using the micropipettor so that the drop is pinned and looks like a beach ball.
- Next, add 80* microliters of one of the calf thymus (or water blank) solutions listed in the table above. You have just made a "drop" or "sample."
- Align the drop by moving the slide so that the blue LED light is focused on the drop to the middle of the black fiber optic fitting on the other side of the drop.
- Use the timer on the camera so that you can take a picture after covering the fluorimeter and camera with the lightbox. The light box should block out most of the light from the surroundings, but do not worry if a little light is coming into the lightbox.
- Take three pictures of the drop being careful to check that the drop is focused on the camera.
- Remove the lightbox. Be careful not to move the smart phone as you move the light box.
- Use the micropipettor to remove the 160 microliter drop from the surface of the slide.
- Move the slide to the next position.
- Repeat steps all of the steps above for the other concentrations of calf thymus DNA.
- You can use several slides if you make a mistake or want to rerun the calibration.
Data Analysis
Positive control photo:
Negative control photo:
ImageJ values:
Note: In the table above, 7 refers to patient ID# 78826 and 9 refers to ID# 96337.
Solutions used for Products:
Calibration Curve:
Concentration Data Table:
SNP Information & Primer Design
Background Information about SNPs (Single Nucleotide Polymorphisms):
Single Nucleotide Polymorphisms (SNPs) are the most common type of genetic variation among people. SNPs are pronounced like "snips." Single Nucleotide Polymorphisms are found in more than one percent of the general population. It is a challenge for scientists to find correlations between SNPs and particular effects in patients. Single Nucleotide Polymorphisms can act as biological markers so that scientists can pin-point which genes are associated with certain diseases. Most SNPs have no effect on human health and development, but some SNPs have been found to help scientists predict a patient's response to certain medicines and environmental factors such as toxins.
Nucleotides are the individual building blocks of nucleic acids. They come in four varieties: adenine, thymine, guanine and cytosine. These are denoted by the letters A, T, G and C respectively.
The rs16991654 SNP is found in Homo sapiens. It is located on the 21:34370656 chromosome and is associated with the KCNE2 gene. It is pathogenic and is linked to Long QT syndrome.
What does KCNE2 stand for?
Potassium voltage-gated channel
Molecular Function of this gene:
They regulate the release of neurotransmitters, heart rate, secretion of insulin, muscle contraction, and cell volume.
Describe an allele: An allele is an alternate form of a gene. There can be many different alleles for the same gene.
The disease-associated allele:
CTC rather than TTC
The numerical position of the SNP:
34370656
Non-disease forward primer (20 nt):
5’ CATGGTGATGATTGGAATGT
Numerical position exactly 200 bases to the right of the disease SNP:
34370856
Non-disease reverse primer:
5’ CCCTTATCAGGGGGACATTT
Disease forward primer (20 nt):
5’ TGGTGATGATTGGAATGCTC
Disease reverse primer (20 nt):
5’ CCCTTATCAGGGGGACATTT
Think about why the disease primers do not have a match
The reason the disease primers do not have a match with the normal human genome is that the diseased primers have a different order of nucleotides than the healthy genome. Therefore, the strands will not match up correctly.
|
BME 100 Fall 2014
