BME100 f2014:Group5 L5

BME 100 Fall 2014	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Error creating thumbnail: Unable to save thumbnail to destination Name: Sahar Mohamed Error creating thumbnail: Unable to save thumbnail to destination Name: Megan Danforth Error creating thumbnail: Unable to save thumbnail to destination Name: Keaton Sorenson Error creating thumbnail: Unable to save thumbnail to destination Name: Zahra Khuraidah Error creating thumbnail: Unable to save thumbnail to destination Name: Jad Jazzar Error creating thumbnail: Unable to save thumbnail to destination Name: Christopher Rojas LAB 5 WRITE-UP Procedure Smart Phone Camera Settings Type of Smartphone: Galaxy S5 Flash: off ISO setting: 800 White Balance: Auto Exposure: N/A Saturation: N/A Contrast: N/A Calibration Error creating thumbnail: Unable to save thumbnail to destination Distance between the smart phone cradle and drop = 4 cm Solutions Used for Calibration Concentration of 2X Calf Thymus DNA solution (micrograms/mL) Volume of the 2X DNA solution (μL) Volume of the SYBR GREEN I Dye Solution (μL) Final DNA concentration in SYBR Green I solution (μg/mL) 5 80 80 2.5 2 80 80 1 1 80 80 0.5 0.5 80 80 0.25 0.25 80 80 0.125 0 80 80 0 Placing Samples onto the Fluorimeter Set up the fluorimeter so that the phone taking pictures is around 4 cm away and on the same height as the laser. Insert a new slide rough side up into the fluorimeter. Adjust the slide so that the small circles are bisected by the laser. Choose one of the circles intersected by the laser and add 80 μL of SYBR Green I solution. Choose another circle intersected by the laser that is next to the circle with the SYBR Green I solution just added and add 80 μL of Calibration or Sample. The drops should meet in between the circles and stay in the beam of the laser. Take the picture of the sample and make sure the photo is focused. Data Analysis Representative Images of Negative and Positive Samples Positive Negative Image J Values for All Calibrator Samples Image J Values ' Concentration:Trial Area Mean RawIntDenDrop RawIntDenBackground Drop - Background 0:01 30296 6.622 200607 370484 -169877 0:02 33176 5.065 168041 362721 -194680 0:03 42752 16.918 723296 222323 500973 0.25:1 45248 7.407 335160 225188 109972 0.25:2 52264 7.761 406514 235836 170678 0.25:3 53056 8.307 440762 237667 203095 0.5:1 53056 26.256 1393022 303124 1089898 0.5:2 55440 30.559 1694169 351414 1342755 0.5:3 52264 22.941 1198970 293019 905951 1:01 51464 41.373 2129230 383303 1745927 1:02 49484 45.434 2248274 427959 1820315 1:03 53844 46.975 2529329 297738 2231591 2:01 51160 77.946 3987708 540998 3446710 2:02 54956 77.778 4274351 366331 3908020 2:03 53440 80.505 4302196 665487 3636709 5:01 58532 118.406 6930527 473292 6457235 5:02 59608 110.692 6598123 511418 6086705 5:03 56840 115.993 6593021 407957 6185064 1 2 3 Average Standard Deviation X-Axis Int 0 -169877 -194680 500973 45472 394670.328189237 0 0.25 109972 170678 203095 161248.333333333 47272.2142736442 0.25 0.5 1089898 1342755 905951 1112868 219306.063023802 0.5 1 1745927 1820315 2231591 1932611 261582.059660062 1 2 3446710 3908020 3636709 3663813 231846.283422875 2 5 6457235 6086705 6185064 6243001.33333333 191939.238224844 5 Calibration curve PCR Results Summary Our positive control PCR result was 1.41 μg/mL Our negative control PCR result was 0.3 μg/mL Observed results Patient 54942: Negative Patient 69456: Positive Conclusions Patient 54942 : Not infected with disease Patient 69456 : Infected with disease SNP Information & Primer Design Background: About the Disease SNP Polymorphism is when there is genetic variation within a population. This can occur through natural selection. Nucleotides are the basic structural units of DNA, when the bases are switched this causes genetic variations or mutations. The SNP rs16991654 is only found in humans (Homo sapiens) and occurs on the 21st chromosome. The clinical significance of this SNP is that it is a pathogenic allele. The gene affected by this SNP is KCNE2, which stands for potassium voltage-gated channel, Isk-related family, member 2. KCNE2 gene has a variety of functions these include: regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. An allele is two or more alternative forms of a gene that are created through mutations and are located on the same place on a chromosome. When this gene contains the disease-associated allele sequence is CTC. Primer Design and Testing The primers we created worked as expected. The primers were created by isolating where the disease SNP is located in the genome. With that location, 20 base pairs were matched on either side of the disease coding sequence so that primers could be created at that specific location. In layman's terms, the primers hold the coordinates to the corresponding location on the human genome. The Non-Disease Primers (Forward and Reverse) worked and created the 220bp long sequence where the disease would be. The Disease Primers (Forward and Reverse) contained no matches. This is because the primers are trying to match onto DNA that does not contain the disease. The forward primer cannot attach because of the difference in base pairs between the forward non-disease primer (CATGGTGATGATTGGAATGT) and the forward disease primer (CATGGTGATGATTGGAATGC). The only difference is the T changes to a C in the disease primer. The reverse primers for disease and non-disease are the same. The following pictures are from the test to tell if the primers will work. Error creating thumbnail: Unable to save thumbnail to destination