BME100 f2014:Group3 L5

BME 100 Fall 2014	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Error creating thumbnail: Unable to save thumbnail to destination Name: Marissa Seelhammer Error creating thumbnail: Unable to save thumbnail to destination Name: Brianna Denuit Error creating thumbnail: Unable to save thumbnail to destination Name: Farhad Eghbalian Error creating thumbnail: Unable to save thumbnail to destination Name: Shane Mitchell Error creating thumbnail: Unable to save thumbnail to destination Name: Catherine Piatak Error creating thumbnail: Unable to save thumbnail to destination Name: Nivenka Mahesh LAB 5 WRITE-UP Procedure Smart Phone Camera Settings Type of Smartphone: iPhone 5 Flash: off ISO setting: default White Balance: default Exposure: default Saturation: default Contrast: default Calibration Using the switch for Blue LED, turn on the excitation light. Turn on smartphone camera and record camera settings used. Place smartphone on phone cradle and, using plastic trays, adjust the height of the fluorimeter so that the camera captures an image of the drop from the side. Adjust the position of the smartphone cradle so that the camera is as close to the drop as possible while still remaining focused on the drop. Using a ruler, record the distance between the smartphone camera and the drop. Distance between our smartphone cradle and drop = 4.5 cm Solutions Used for Calibration Initial Concentration of 2X calf Thymus DNA Solution (µg/mL) Volume of the 2X DNA solution (µL) Volume of the SYBR Green 1 Dye Solution (µL) Final DNA concentration in SYBR Green 1 Solution (µg/mL) 5 80 80 2.5 2 80 80 1 1 80 80 0.5 0.5 80 80 0.25 0.25 80 80 0.125 0 80 80 0 Bonus Error creating thumbnail: Unable to save thumbnail to destination This picture shows our smartphone resting in the phone cradle, 4.5 cm away from the slide where the drop is placed. Error creating thumbnail: Unable to save thumbnail to destination This picture shows our setup in the black box that will be used to block out light. Once the camera's timer is set off, the front flap of the box will be closed so no light interferes with the picture. Placing Samples onto the Fluorimeter 1. Power on the Fluorimeter so that the light appears. Adjust the slide until the light is shining between two of the indentations on the slide. It should align in the middle. 2. Obtain a micro pipette and adjust it to 80mL. Get a new tip for the pipette, and pipette 80mL of the SYBR Green I on the slide in between the dots from the previous step. Dispose of the tip into a sharps waste container. 3. Repeat the last step with 80mL of the DNA sample. Pipette the DNA into the SYBR Green I dot. 4. Using a smartphone camera with a timer, place it into the phone cradle at 4.5 centimeters away from the location of the drop (following the calibration settings). Close the box to enclose darkness around the sample. When the 3 second timer goes off and the picture is taken, retrieve the camera and store this picture. Repeat this three times. 5. Remove the sample from the slide using the micro pipette. Dispose of the sample into the cup. Remove the tip into the cup. 6. Push the slide so that a new set of dots that have not been exposed to the sample are available. Realign like in step one. Repeat steps two through five using the next sample. Data Analysis Representative Images of Negative and Positive Samples Negative sample: Error creating thumbnail: Unable to save thumbnail to destination It should be noted that there was an error in our experiment causing our negative sample to glow green indicating a positive sample. Therefore, we do not have any drops that are of a truly negative sample. Positive sample: Error creating thumbnail: Unable to save thumbnail to destination Image J Values for All Calibrator Samples Error creating thumbnail: Unable to save thumbnail to destination Additional Tables used for Calculations Error creating thumbnail: Unable to save thumbnail to destination Error creating thumbnail: Unable to save thumbnail to destination Error creating thumbnail: Unable to save thumbnail to destination Error creating thumbnail: Unable to save thumbnail to destination Error creating thumbnail: Unable to save thumbnail to destination Calibration curve Error creating thumbnail: Unable to save thumbnail to destination PCR Results Summary Our positive control PCR result was 8.938 μg/mL Our negative control PCR result was 13.115 μg/mL Observed results Patient 19452 : The values of the three separate trials were 5.94, 6.03, 4.90 μg/mL. The average of these trials is 5.62 μg/mL. The drops were mostly green, though the very tops of the drops had a less intense green color than that of the positive control. Patient 37145 : The values of the three separate trials were 3.51, 4.58, 6.15 μg/mL. The average of these trials is 4.75 μg/mL. The drops had some green glow to them, but the top half was far less green than the positive control and even that of the other patient. Conclusions Patient 19452 : inconclusive Patient 37145 : inconclusive We were unable to draw conclusions about either of our patients because there was an error in our negative control. It appears that somewhere during the experiment's course the negative sample was contaminated with a positive strain of DNA because our negative control drop glowed green, which it should not have done. Because of this error, we are unable to draw any conclusions from our data. SNP Information & Primer Design Background: About the Disease SNP A nucleotide/s is structural components of DNA and RNA (series of building blocks if you will). DNA and RNA assembled of individual nucleotides. Nucleotides are consisting of three organic molecules; a 5 carbon sugar (Deoxyribose or ribose), a phosphate group and one of four set of nitrogenous base (A, T, C and G).Poly means two or more; morphs means, slow variation within a same species. Therefore, polymorphism is an existence of two or more distinct/obvious different phenotype among the populations of a same species (genus if you will). It is found in the Homo Sapiens species. The chromosome variation is located on; 21:34370656. Of this SNP the clinical significance is pathogenic. The gene associated with SNP is KCNE2. The disease associated with this SNP is congenital long QT syndromes (LQTSs). Primer Design and Testing What does KCNE2 stand for? Potassium voltage-gated channel, Isk-related family, member 2 Briefly describe the molecular function of this gene: The KCNH2 gene in human sapiens DNA, codes for a protein that rise to a potassium ion channel. This potassium ion channel is responsible to regulate electrical current activity of the heart beats. If for some reason (such as mutation in a single nucleotide), the functionality of this potassium ion channel inhibited or changed (i.e. lost or gain functionality of ion channel) it may cause a mortal disorder know as long QT syndrome. Patients associated with long QT syndrome, have a potential risk of fatal cardiac arrhythmias or sudden death. What is an allele? An alternative form or different version of a gene, called an allele. Furthermore, these diverse alleles may rise to different phenotypic traits. The disease-associated allele contains what sequence? CTC The numerical position of the SNP is: 34370656 Non-disease forward primer (20 nt): CATGGTGATGATTGGAATGT The numerical position exactly200 bases to the right of the disease SNP is: 34370856 Non-disease reverse primer (20 nt): CCCTTATCAGGGGGACATTT Disease forward primer (20 nt): CATGGTGATGATTGGAATGC Disease reverse primer (20 nt): CCCTTATCAGGGGGACATTT