BYU iGEM/Archive: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Matt Biggs (talk | contribs)
 
(43 intermediate revisions by 7 users not shown)
Line 1: Line 1:
{{Template:BYU iGEM}}
{{Template:BYU iGEM}}
==Parts Database==
[[https://spreadsheets.google.com/spreadsheet/ccc?hl=en&key=tAVBWBda3ggmyLcxX5FH6dw&hl=en#gid=0|BYU iGEM Biological Parts Database]]
==Articles==
==Articles==


===OxyR_Peroxide===
Regulation of the OxyR transcription factor by hydrogen peroxide and the cellular thiol—disulfide status. [http://www.pnas.org/content/96/11/6161.full]
Redox sensing by prokaryotic transcription factors. [http://www.sciencedirect.com/science/article/pii/S0006295299002890#toc1]
===OxyR_Binding===
Computation-Directed Identification of OxyR DNA Binding Sites in Escherichia coli. [http://jb.asm.org/cgi/content/full/183/15/4571]
===OxyR_End===
Sequence Data
OxyR Binding domain on the mnth gene
[[Image:MNTH Gene binding site.jpeg]]
Site 1: TTTTCGTAGT'''CATAATCCTGGTCTATC'''AGAGAAATCA  Source: [http://biocyc.org/ECOLI/NEW-IMAGE?type=OPERON&object=TU0-7321]
Site 2: CTATCAGAGA'''AATCACCACAATCCAT'''TTAAATGAATT  Source: [http://biocyc.org/ECOLI/NEW-IMAGE?type=OPERON&object=TU0-7321]
SoxR Binding domain on the SoxS gene
[[Image:SoxR Gene biniding domain.jpeg]]
Site 1: AATCGCTTTA'''CCTCAAGTTAACTTGAGGA'''ATTATACTCC  [http://biocyc.org/ECOLI/NEW-IMAGE?type=OPERON&object=TU00211]


<b><i>E. coli</i> Colon cancer detector</b>
<b><i>E. coli</i> Colon cancer detector</b>
<b>Thermosensors</b>
[http://www.sciencedirect.com/science?_ob=MImg&_imagekey=B6WSN-4C5HD56-4-1&_cdi=7051&_user=456938&_pii=S0092867402009054&_origin=search&_coverDate=09/06/2002&_sk=998899994&view=c&wchp=dGLbVtz-zSkzk&md5=70e234399b3f96ac4373f26c9551a459&ie=/sdarticle.pdf That paper that Dr. Griffitts suggested]
[[:Image:TSprimers.pdf|PDF with primer sequences]]
[[:Image:ThermoswitchSequencesBYUiGEM.pdf|PDF with ΔTRS mutation sequences]]
[http://www.reference-global.com/doi/pdf/10.1515/BC.2008.150 Thermoswitch Sequence]
<b>Multiple Cloning Site Map</b>
[[Image:IMAG0070.jpg|thumb|center|Click image to enlarge.]]


<b>Useful ROS Transcription factor articles</b>
<b>Useful ROS Transcription factor articles</b>
[http://ecocyc.org/ Ecocyc.org (anything you want to know about E. coli]
[http://www.ncbi.nlm.nih.gov/gene/1039198 SoxR Sequence Info at NCBI]
[http://www.ncbi.nlm.nih.gov/nucleotide/?Db=gene&Cmd=retrieve&dopt=full_report&list_uids=948462 OxyR Sequence Info at NCBI]


[http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6TCW-42BSR1X-11&_user=456938&_coverDate=03%2F01%2F2001&_alid=1618440669&_rdoc=1&_fmt=high&_orig=search&_origin=search&_zone=rslt_list_item&_cdi=5181&_sort=r&_st=13&_docanchor=&view=c&_ct=42&_acct=C000021830&_version=1&_urlVersion=0&_userid=456938&md5=243c76c742f72641b4bcf88997d33f07&searchtype=a Redox-operated genetic switches: the SoxR and OxyR transcription factors (Review)]
[http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6TCW-42BSR1X-11&_user=456938&_coverDate=03%2F01%2F2001&_alid=1618440669&_rdoc=1&_fmt=high&_orig=search&_origin=search&_zone=rslt_list_item&_cdi=5181&_sort=r&_st=13&_docanchor=&view=c&_ct=42&_acct=C000021830&_version=1&_urlVersion=0&_userid=456938&md5=243c76c742f72641b4bcf88997d33f07&searchtype=a Redox-operated genetic switches: the SoxR and OxyR transcription factors (Review)]


[http://www.annualreviews.org/doi/pdf/10.1146/annurev.biochem.77.061606.161055 Cellular defenses against superoxide and hydrogen peroxide.]
[http://www.ncbi.nlm.nih.gov/pubmed/19892202 Techniques to isolate O2-sensitive proteins: [4Fe-4S]-FNR as an example.]


[http://mic.sgmjournals.org/cgi/content/full/156/5/1487 Molecular characterization of FinR, a novel redox-sensing transcriptional regulator in Pseudomonas putida KT2440.]
[http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6TF8-50H1WM2-8&_user=456938&_coverDate=02/01/2011&_rdoc=1&_fmt=high&_orig=search&_origin=search&_sort=d&_docanchor=&view=c&_searchStrId=1625952567&_rerunOrigin=google&_acct=C000021830&_version=1&_urlVersion=0&_userid=456938&md5=9cee4c02a4a02ca16abc322336de97cc&searchtype=a A genetically encoded sensor for H2O2 with expanded dynamic range (OxyR with YFP)]


[http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6TF8-50H1WM2-8&_user=456938&_coverDate=07/10/2010&_rdoc=1&_fmt=high&_orig=search&_origin=search&_sort=d&_docanchor=&view=c&_searchStrId=1615613785&_rerunOrigin=google&_acct=C000021830&_version=1&_urlVersion=0&_userid=456938&md5=e45d044f9218aaea6b53bd22079fb272&searchtype=a A genetically encoded sensor for H2O2 with expanded dynamic range]
[http://onlinelibrary.wiley.com/doi/10.1111/j.1365-2672.2009.04514.x/full Rapid in vivo screening system for anti-oxidant activity using bacterial redox sensor strains.]


[http://onlinelibrary.wiley.com/doi/10.1111/j.1365-2672.2009.04514.x/full Rapid in vivo screening system for anti-oxidant activity using bacterial redox sensor strains.]
[http://www.annualreviews.org/doi/pdf/10.1146/annurev.biochem.77.061606.161055 Cellular Defenses against Superoxide and Hydrogen Peroxide]
 
<b>AND Gate Articles</b>


[http://partsregistry.org/Part:BBa_F2620 Logical "And" switch part from iGEM registry]
[http://partsregistry.org/Part:BBa_F2620 Logical "And" switch part from iGEM registry]
<b>Other Colon Cancer Articles</b>


[http://cebp.aacrjournals.org/content/12/10/1095.full.pdf+html Detection of Gastric Cancer and Premalignant Lesions by Novel Marker Glycoprotein 87 Using Monoclonal Antibody Adnab-9]
[http://cebp.aacrjournals.org/content/12/10/1095.full.pdf+html Detection of Gastric Cancer and Premalignant Lesions by Novel Marker Glycoprotein 87 Using Monoclonal Antibody Adnab-9]
Line 31: Line 87:
[http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6TCW-42BSR1X-11&_user=456938&_coverDate=03%2F01%2F2001&_rdoc=1&_fmt=high&_orig=search&_origin=search&_sort=d&_docanchor=&view=c&_searchStrId=1618397411&_rerunOrigin=scholar.google&_acct=C000021830&_version=1&_urlVersion=0&_userid=456938&md5=a53c60889b46317652c5182edccccc70&searchtype=a OxyR and Soxr Transcription Factors]
[http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6TCW-42BSR1X-11&_user=456938&_coverDate=03%2F01%2F2001&_rdoc=1&_fmt=high&_orig=search&_origin=search&_sort=d&_docanchor=&view=c&_searchStrId=1618397411&_rerunOrigin=scholar.google&_acct=C000021830&_version=1&_urlVersion=0&_userid=456938&md5=a53c60889b46317652c5182edccccc70&searchtype=a OxyR and Soxr Transcription Factors]


<b>Biomarkers</b>


<b>UCP1 heat generation in yeast/<i>E. coli</i></b>
[http://partsregistry.org/wiki/index.php?title=Part:BBa_K115002 Parts that activate translation at 37°C -- for more parts, change the final 2 in URL to 3 or 9]
 
[http://www.nature.com/nature/journal/v408/n6812/abs/408609a0.html Coenzyme Q is an obligatory cofactor for uncoupling protein function]
 
[http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B8JG4-4X7GMRS-3&_user=456938&_coverDate=12%2F31%2F2009&_rdoc=1&_fmt=high&_orig=search&_origin=search&_sort=d&_docanchor=&view=c&_acct=C000021830&_version=1&_urlVersion=0&_userid=456938&md5=c3da71ec96c31871511d7f794748086d&searchtype=a Yeast cultures with UCP1 uncoupling activity as a heating device]
 
[http://4e.plantphys.net/article.php?ch=&id=126 Temperature Regulation by Thermogenic Flowers]
 
 
<b>CO Detection/<i>E. coli</i></b>
 
[http://www.pnas.org/content/94/21/11216.full CO sensing transcription factor]


[http://video.google.com/videoplay?docid=-2704243649439977137# Bio Thermometer 1 (youTube video)]


<b>Sound Detection</b>
[http://igem-victoria.pbworks.com/w/page/7992064/Bio-Thermometer Bio Thermometer 2]
 
[http://www.annualreviews.org.erl.lib.byu.edu/doi/full/10.1146/annurev.physiol.59.1.633 Mechanosensitive Channels of ''E. Coli'']
[http://www.annualreviews.org.erl.lib.byu.edu/doi/full/10.1146/annurev.biophys.37.032807.125836 Eukaryotic Mechanosensitive Channels]
[http://www.fasebj.org/content/20/7/811.full Cellular Mechanotransduction]
[http://www.sciencedirect.com.erl.lib.byu.edu/science?_ob=ArticleURL&_udi=B6WW3-4J0PF31-6&_user=456938&_coverDate=01/31/2006&_rdoc=6&_fmt=high&_orig=browse&_origin=browse&_zone=rslt_list_item&_srch=doc-info(%23toc%237119%232006%23999899998%23614710%23FLA%23display%23Volume)&_cdi=7119&_sort=d&_docanchor=&_ct=17&_acct=C000021830&_version=1&_urlVersion=0&_userid=456938&md5=d0bd887e8c7174384acda5b26e04cfc0&searchtype=a Mechanisms of Mechanotransduction]
[http://www.jbc.org.erl.lib.byu.edu/content/277/31/27682.full Functional Design of Bacterial Mechanosensitive Channels]
 
<b>Biomarkers</b>


[http://en.wikipedia.org/wiki/Carcinoembryonic_antigen Carcinoembryonic antigen]
[http://en.wikipedia.org/wiki/Carcinoembryonic_antigen Carcinoembryonic antigen]
Line 77: Line 116:


[http://www.hindawi.com/journals/jbb/2010/232016.html Biology by Design]
[http://www.hindawi.com/journals/jbb/2010/232016.html Biology by Design]
<b>Inversion Recombinase Mechanisms</b>
[http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0002815 Design and Construction of a Double Inversion Recombination Switch for Heritable Sequential Genetic Memory]
<b>Schools for Synthetic Biology</b>
[http://syntheticbiology.org/Graduate.html]
<b>Potential Mechanisms</b>
<p>[[Image:IGEM Mechanism.jpg|650px|center]]</p>
<p>[[Image:Flip Recombinase.JPG|650px|center]]</p>
<p>[[Image:Cre-Lox Mech.JPG|700px|center]]</p>

Latest revision as of 19:54, 20 July 2011

Parts Database

[iGEM Biological Parts Database]

Articles

OxyR_Peroxide

Regulation of the OxyR transcription factor by hydrogen peroxide and the cellular thiol—disulfide status. [1]

Redox sensing by prokaryotic transcription factors. [2]

OxyR_Binding

Computation-Directed Identification of OxyR DNA Binding Sites in Escherichia coli. [3]

OxyR_End

Sequence Data

OxyR Binding domain on the mnth gene

Site 1: TTTTCGTAGTCATAATCCTGGTCTATCAGAGAAATCA Source: [4]

Site 2: CTATCAGAGAAATCACCACAATCCATTTAAATGAATT Source: [5]

SoxR Binding domain on the SoxS gene

Site 1: AATCGCTTTACCTCAAGTTAACTTGAGGAATTATACTCC [6]

E. coli Colon cancer detector

Thermosensors

That paper that Dr. Griffitts suggested

PDF with primer sequences

PDF with ΔTRS mutation sequences

Thermoswitch Sequence

Multiple Cloning Site Map

Click image to enlarge.

Useful ROS Transcription factor articles

Ecocyc.org (anything you want to know about E. coli

SoxR Sequence Info at NCBI

OxyR Sequence Info at NCBI

Redox-operated genetic switches: the SoxR and OxyR transcription factors (Review)

Techniques to isolate O2-sensitive proteins: [4Fe-4S-FNR as an example.]

A genetically encoded sensor for H2O2 with expanded dynamic range (OxyR with YFP)

Rapid in vivo screening system for anti-oxidant activity using bacterial redox sensor strains.

Cellular Defenses against Superoxide and Hydrogen Peroxide

AND Gate Articles

Logical "And" switch part from iGEM registry

Other Colon Cancer Articles

Detection of Gastric Cancer and Premalignant Lesions by Novel Marker Glycoprotein 87 Using Monoclonal Antibody Adnab-9

Colon Cancer biomarker (Lgr5 protein)

Redox signaling and gene control in the Escherichia coli soxRS oxidative stress regulon - A review

The Universal Character of the Tumor-Associated Antigen Survivin

Biomarkers for Early Detection of Colon Cancer

OxyR and Soxr Transcription Factors

Biomarkers

Parts that activate translation at 37°C -- for more parts, change the final 2 in URL to 3 or 9

Bio Thermometer 1 (youTube video)

Bio Thermometer 2

Carcinoembryonic antigen

Prostate-specific antigen

ROS is decreased in cancerous cells

Toolbox

Synthetic Biology Tools

Synthetic Biology and Engineering Rules

Synthetic Gene Circuit

Directed Evolution of a Genetic Circuit

Microbial Metabolism

Mathematical Modeling

Biology by Design

Inversion Recombinase Mechanisms

Design and Construction of a Double Inversion Recombination Switch for Heritable Sequential Genetic Memory

Schools for Synthetic Biology [7]

Potential Mechanisms