IGEM:Stanford/2009/Project Homeostasis/sequences/SoxSPromoter

From OpenWetWare

Jump to: navigation, search


Home Team Project Parts Notebook Archives

SoxS Promoter

  • Sequence: length= 105



  • Forward Primer: gtttcttcgaattcgcggccgcttctagagaatcgctttacctcaagttaacttgagg
    • Length= 58 GC= 46.6% Melt= 68.6C

  • Reverse Primer: gtttcttcctgcagcggccgctactagtacagttcgttaattcatctgttggggag
    • Length= 56 GC= 50% Melt= 69.5C

Research Proposal
Systems Overview
Cloning Plan
Sequences & Primers
Device Overview
Parts Design
Device Overview
Parts Design
Future Work
Archived Work
Personal tools