IGEM:Stanford/2009/Project Homeostasis/sequences/SoxR

From OpenWetWare

Jump to: navigation, search

 

Home Team Project Parts Notebook Archives


SoxR gene

  • Sequence: length= 506

gaattcgcggccgcttctagATGGAAAAGAAATTACCCCGCATTAAAGCGCTGCTAACCCCCGGCG AAGTGGCGAAACGCAGCGGTGTGGCGGTATCGGCGCTGCATTTCTATGAAAGTAAAGGGTT GATTACCAGTATCCGTAACAGCGGCAATCAGCGGCGATATAAACGTGATGTGTTGCGATATG TTGCAATTATCAAAATTGCTCAGCGTATTGGCATTCCGCTGGCGACCATTGGTGAAGCGTTT GGCGTGTTGCCCGAAGGGCATACGTTAAGTGCGAAAGAGTGGAAACAGCTTTCGTCCCAAT GGCGAGAAGAGTTGGATCGGCGCATTCATACCTTAGTGGCGCTGCGTGACGAACTGGACGG ATGTATTGGTTGTGGCTGCCTTTCGCGCAGTGATTGCCCGTTGCGTAACCCGGGCGACCGCT TAGGAGAAGAAGGTACCGGCGCACGCTTGCTGGAAGATGAACAAAACTAActgcagcggccgct

actagta


  • Forward Primer: gtttcttcgaattcgcggccgcttctagatggaaaagaaattaccccgcattaaagc
    • Length= 57 GC= 45.6% Melt= 68.8C


  • Reverse Primer: gtttcttcctgcagcggccgctactagtattagttttgttcatcttccagcaagcgtg
    • Length= 58 GC= 48.3% Melt= 69.5C



Project
Research Proposal
Systems Overview
Cloning Plan
Sequences & Primers
Anti-Inflammation
Device Overview
Parts Design
Challenges
Results
Anti-Immunosuppression
Device Overview
Parts Design
Challenges
Results
Protocols
Modeling
Overview
Notebook
Results
Future Work
Archived Work
Personal tools