Biomod/2011/TeamJapan/Sendai/Notes/Stick

From OpenWetWare

Jump to: navigation, search

Contents

Robot Design

This design is a very simple one, where it is combined only four DNA double strands.The sticky motif robot was our plan B in case we failed to produce the triangular prism robot.In addition the legs design include both kind of robots for saving time and costs. It assumes that how to move is the same as a triangular prism.

For producing sticky motif we used the viral M13mp18 DNA single strand (M13) as scaffold. But we only used 469 bases of 7,249 bases , then having a leftover. In this situation we thought about cutting the part of M13 that we needed. Our first attempt was to extract the necessary part of M13 to reproduce M13 with polymerase chain reaction. But we failed. So we changed our method for cutting the M13 with restriction enzyme(bglⅠ,EcoR).

Figure 1.Sticky motif design in caDNAno
Figure 1.Sticky motif design in caDNAno
Figure 2.cut M13
Figure 2.cut M13


Experiment

  • Electrophoresis
Figure 3.result of cut M13. 1; whole M13, 2; M13 after cut treatment for triangle prism, 3; M13 after cut treatment for sticky motif, and 4; 100bp DNA Ladder. A; the band of whole M13. B; the band of shorter M13 which we use in our DNA origami for triangle prism. C; the band of shorter M13 which we use in our DNA origami for sticky motif
Figure 3.result of cut M13. 1; whole M13, 2; M13 after cut treatment for triangle prism, 3; M13 after cut treatment for sticky motif, and 4; 100bp DNA Ladder. A; the band of whole M13. B; the band of shorter M13 which we use in our DNA origami for triangle prism. C; the band of shorter M13 which we use in our DNA origami for sticky motif

gel:1.0% agarose gel
buffer:1×TAE

For producing the sticky motif robot body, firstly we used whole M13mp18 DNA single strand (M13) as scaffold. However, 469 bases of 7,249 bases were used in our design. Thus, no used region of M13 was cut with restriction enzyme (Bgl I and EcoR). The reason why the band of C is smaller amount than the band of D is that the samples was purified by QIAGEN PCR purification kit, by which longer DNA (>5000bp) is not effectively purified, before loading gels.

Protocol

  • Cut M13

To cut m13, specific part of m13 sequence form a double helix, secondly react by enzyme, finally clean up of discarded enzyme and pick out only M13.The process is shown below.

1.Form a double helix
Mix 5μL M13(84nM), 3μL DNA that specific part of m13 sequence form a double helix(5μM), 2μL 10×H buffer, and 11μL mQ. Set in PCR, the condition is 3min at 95°C, 3min at 65°C, for the duration of enzyme reaction, let the sample at 37°C.

2.Cutting M13 by enzyme reaction
Add 0.5μL BglⅠ and EcoR in the sample, let the sample stand for 1 hours at 37°C.

3.Clean up of enzyme
This protocol is [here]

Conclusion

Since there was no time in this time, time was not able to be spared for sticy motif. Therefore, it did not go by electrophoresis to the check of structure. Structure is so small that we can not observed sticky motif under the AFM. So we wanted to check structure by whether sticy motif and the field which attached C-leg are mixed, and structure is attached to the position of the start, but a structure did not ride on the field, so a plan did not progress.

DNA sequence

Figure 4.caDNAno design: Schematic design of M13mp18 (thin line colored sky-blue) and staples
Figure 4.caDNAno design: Schematic design of M13mp18 (thin line colored sky-blue) and staples

ACCCGTCGGATTCTCCGTGG
GAACAAACGTTTGTTAATTTTTT
CGTATCGGCCTTTCGCTGACATTCAGGC
TAAATGTCAGCTCAAATTCGCGTTAAATTT
GATAGGTTACGTCAACAT
CTCCAGCCAGCTTTCCCTGCCAGTTTGAGGAAGATTGTAATCAGAA
TGGCCTTCCTGTAGCCAGCTTTCATTGGGAACGCCA
CGTAACCGTGCATGGCCCATTCGCTATAAGCA
TCAAAAATAATTCGCGTC
AATATTTAAATTGATAGTGTAGATGGGCGCAT
GAAACCAGCTGTTGGGAAG
TTGTTAAATGAGCGAGTAACA
AACCATAAACAAAAACAGGGGAATGG
TGCGCAAGCAAAGCGACCGCTTCTGGTGCCG
AAGCCCCGTTAATATGCGGATTGACCGTACGACGAC
GGCGATCGGTGCGGGCCTCCAGGAAGATCGCA

Personal tools