Biomod/2011/TeamJapan/Sendai/Notes/Hexa

From OpenWetWare

Jump to: navigation, search


Contents

Robot Design

Figure1.Hexagonal prism in caDNAno
Figure1.Hexagonal prism in caDNAno

A DNA Spider structure, based on a protein body with three legs attached to it, is the forefront of the current design of molecular robots consisting of biological molecules. DNA Spider moves randomly, therefore tending to move towards not controlled directions. Furthermore, number and movement of legs are restricted by the protein body of the DNA spider. In the present work, we design a DNA-based body for the molecular robot in order to improve common DNA Spiders, letting the possibility of including many legs as required. Our robot is provided with three kinds of legs corresponding to three different scaffolds in the field. Because the order that a leg grounds on the field can be determined and cutting the scaffolds while walking, this robot always goes forward.

Experiment

Annealing

Figure2.Annealing condition
Figure2.Annealing condition

By using PCR, the experiment requires the following conditions for the annealing:

Initial temperature: 80°C
80°C → T°C      ・・・ 100 min
T°C → room temperature (24°C)   ・・・ 200 hour

T = 50,60,70

By using the method of the bubbling water, the styrene foam container was filled with the hot water at 95 °C. Then, the sample was placed in the hot water for about two days.

Electrophoresis

  • Gel: 0.7% agarosegel
  • Buffer: 1×TAE Mg2+
  • Electrophoretic condition: 90 min in 100V
Figure 3. #1: only M13. #2, #3 and #4: annealing type at 60 °C. #5, #6 and #7: annealing at 50°C. #2 and #5: M13:staple=1:1. #3 and #6: M13:staple=1:5. #4 and #7: m13:staple=1:10.
Figure 3. #1: only M13. #2, #3 and #4: annealing type at 60 °C. #5, #6 and #7: annealing at 50°C.
#2 and #5: M13:staple=1:1. #3 and #6: M13:staple=1:5. #4 and #7: m13:staple=1:10.

In this electrophoresis experiment, DNA were stained by SYBR Gold (sigma) except when the DNA nanostructure was observed with fluorescence. We tested the influence of ratio to make our structure, by changing concentration ratio between M13 and staples. As a result, at 50°C and 60°C, since a band appears above M13, it was demonstrated that the structure with a larger molecular weight than M13 exists. Since the band under M13 is as large as the M13:staple becomes larger, the band under M13 indicates surplus staples.


Figure 4. #1, #2 and #3: annealing type at bubbling water. #4: only M13. #5, #6 and #7: annealing type at 70°C #1 and #5: M13:staple=1:1. #2 and #6: M13:staple=1:5. #3 and #7: M13:staple=1:10.
Figure 4. #1, #2 and #3: annealing type at bubbling water. #4: only M13. #5, #6 and #7: annealing type at 70°C
#1 and #5: M13:staple=1:1. #2 and #6: M13:staple=1:5. #3 and #7: M13:staple=1:10.

In this electrophoresis experiment, DNA were stained by SYBR Gold (sigma) except when the DNA nanostructure was observed with fluorescence. This case is the same as the previous experiment, where we tested the influence of ratio to make our structure, by changing the concentration M13:staples. As a result, at 70°C and bubbling water, the band above M13 which was visible by 50°C and 60°C was not able to be checked. Since no moving in the sample M13:staple=1:5 at 70 °C can be checked, it is thought that the big structure which cannot move in 0.7% agarose gel would be obtained.


Figure 5. #1 and #6: only M13. #2, #3, #4 and #5; M13:staple=1:5. #7, #8, #9 and #10: M13:staple=1:10. #2 and #7: annealing type at 50 °C. #3 and #8: annealing type at 60 °C. #4 and #9: annealing type at 70 °C. #5 and #10: annealing type at bubbling water.
Figure 5. #1 and #6: only M13. #2, #3, #4 and #5; M13:staple=1:5. #7, #8, #9 and #10: M13:staple=1:10.
#2 and #7: annealing type at 50 °C. #3 and #8: annealing type at 60 °C. #4 and #9: annealing type at 70 °C. #5 and #10: annealing type at bubbling water.

In this electrophoresis, DNA were stained by SYBR Gold (sigma) except observing DNA with fluorescence. We tested the influence of ratio to make our structure, by changing annealing temperature. It turns out that it is 60°C that the band above M13 has come out strongly, and it is only 70 °C that as big a structure as electrophoresis cannot be carried out was made.


Figure 6. Samples are as follows: #1 and #7: only M13. #2 and #8: Dyna Marker K bp ladder. #3, #4, #5, #6 and #10: M13:staple=1:10. #9: only staple. #2 and #7: annealing type at 50 °C. #3 and #8: annealing type at 60 °C. #4 and #9: annealing type at 70 °C. #5 and #10: annealing type at bubbling water
Figure 6. Samples are as follows: #1 and #7: only M13. #2 and #8: Dyna Marker K bp ladder. #3, #4, #5, #6 and #10: M13:staple=1:10. #9: only staple. #2 and #7: annealing type at 50 °C. #3 and #8: annealing type at 60 °C. #4 and #9: annealing type at 70 °C. #5 and #10: annealing type at bubbling water

In this electrophoresis experiment, DNA were stained by SYBR Green (sigma) except when the DNA nanostructure was observed with fluorescence. We tested the influence of appearing in result, by changing stain solution. It turns out that the band below M13 has come out deeply in order of 50 °C, 60 °C, 70 °C, and hot water. Moreover, it turns out that the band has not come out of staple which has not carried out annealing at all.


Conclusions

The design of a hexagonal prism has a large form and its structure is also strong. However, we found some difficulties related with this structure, so we decided to change our design.

  • The difficulty in verifying the 3D body design.
  • The time cost that is necessary to get the robot annealed.
  • The complexity of the structure due to the different variety of staples.


DNA sequence

Figure 7. caDNAno design: Schematic design of M13mp18 (thin line colored sky-blue) and staples
Figure 7. caDNAno design: Schematic design of M13mp18 (thin line colored sky-blue) and staples

ACGGTGTCTGGAAGTTTCACGTAATGGGTGGCTTAGAGCTTA
AGCCAGCTAAAGTGTACCAGTCG
TCCTGTTAACAGTATTACAGCGGTTGATAGCAAGGCAAAGAAT
CGAGTAGATTTAGTTGGCCT
TTTTAAATATGCAATAAATGTGA
GCGAGTAAAAATAATTCGCGTCTTGACCATTAGATACATT
TCGGATTTGCTGTAGCTCAACATG
TCGCAAATGGTCAACAATAGGAACGCCATCAACAACCCG
ATTGCTGAATATAACTCCGTGGG
AACAAACGGGCTCATTTTTTAACTAACCTG
TTTAGCTTTTTTGTTAAATCACGGATTGACTTCCATA
TTGCGGAATAGGTCACGTTGGGTTAAAATTCAGAAAA
TAATATTTTTGTAGATGGGCGCAGTCATTT
GGCGCGAGCTGAAATGTAAACGT
CCTTTTGATAAGAGTCGTAACCGT
GCATCTGCGCAAATATTTAAATAGGTGGC
AGGGGACAGAGTACCTTTAATTGCT
ATCAATTCTACTAATGTATAACAGTTTG
CAGGTCAGGATTGGCTTCAAA
CAGGAAGACGGTAATCTGCCGGAAACCAAGGACGACAAAAAA
GCCCCGTATCGGGAAGCAAACTCCAA
TCCAATAAATCATACAGATCGCATTAAAATATTTTCATTTGG
TCAAAGCGAACCAGACCGCCTCAGGAAGATGTAGAAAAACTCAC
TAGCAAATCATATGTACCCCGCACTCCAGCGAAGGCCGGAG
TATCGCGGGTATTATAGTCAG
CCTCAGAGCATAAAAATCGATGAATTAGTAGTAGCATTAACA
GGAAGCCCGAAAGACAAAGCGCCA
TTCGCCATGGAGCAAACAAGAGGCTAAAT
GCGCAACGCATCAAAAAGATTAAGA
CGGTTGTACCAAAAAGAGTCTTCAGGCT
AAGCAAAGCGGATTTGTTGGGCAGGTCATTGCCTGACATTAT
GGCTATAAGGGCGACCACCGCTTCTGGGTAAAACTATACAAA
GACCCTGTCGCATGTCAAATTAAGCAATAAAG
AATCAGGTCTTTACCCTGATCGGTGCGGGCATTTGGGTAAC
ATTACGCGAATGACCATAAATCAAA
GAGAAGCCTTTATTCTATTTTCTTCGCT
AGTTCAGAAAACGACAGCTGGGCCGGAGA
GGGTAGTCAACGCAAGGATAAAA
AAATTAATCGAAAGGGGGATGTTTTAAAC
ATTTTTAGAACCCTCTAGCTGAT
TCCCCCTCAAATTAGTAAAAT
CGATTAAGGATATTCAACCGTTCATATAT
GCCAGGGTAAATATTCATTGAA
TTTAAATATCACCATCAATCTTGAGAGATAATACTTTTGCGG
TCGTCATTTTCCCAGTCACCAGCTTTCCTTTTAATTCGAGCT
ACAGTCAAGCAATGCCTGAGTA
ATGTGTAGGTAAAAGCGGTCC
GTTTAGACTGGATAGCGTAAACGACGGCCACTTCGAATTC
TGCAGCAGATTCAGCGTTGCGCTCAAAGGGCGAAAA
TTGCATGAGGGGGTAAGCGCTGCAAGG
ACGCTGGTTTGCCCGCCCTGAGCCAAGC
AGAAGTTTTGCCAGCCTGCAGCCCTTCAC
CGCCTGCAGCAGGCGAAAATCCT
GCTGATTGGTCGACTCTAGAGGTTGCAAA
GTTTGATGGTGGTTCGGGCAACA
ATAGCGAGAGGCTTATCCCCGGG
TACCGAGCTTTCACCAGTGAGACCGAAAT
GTAATCATGCGATAAAAACCAAA
CGGCAAAAGGGTGGTTTTTGTGAGAGT
CAGACGAGTCATAGCTGTTGTGCCTAATAGATACATAACGCC
TTGGGCGCCATCCCTTATAAATC
AGAGGCGGCTGTGTGAAATTGTCGTTTAC
AAAAGAATAGCCCGCGCGCGGGG
ACTATCATAACCCTTATCCGCTCACAATTCCAATGAAT
CGGCCAAAGATAGGGTTGAGTGTTG
ATACGAGGGCATAGTAAGAGCAAC
TTCCAGTTTGGAACTGTCGTGCCAGCTGCATTACACAAC
AAAAGGAATTACGACCGGAAGCATTTCATCAACATCTAAAGT
GGAAACCAAGAGTCCACTATTAAA
CCGCTTTAAGCCTGGGTCTTTGCGTA
GAACGTGGACTCCAACGTCACTGC
CCACATTCAACTAATGCGAGTGAGCTGATTCATC
ATTAATTAAAGGGTGAGAACGTTGTACCAATACTGCGGAA
AGTTGAGATTTAGGAATA
ACCGTCTATCACGGAACAACATTTGATTCCCAATTCTGCGAA

Personal tools