User:Spenser Skates/Notebook/pTKX luciferase biobrick/2008/04/16

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Project name Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Removal of XbaI site by site-directed mutagenesis

Performed site directed mutagenesis using the following primers for PCR in order to remove the XbaI site.

cattaatgaattgccgaataatctggattttgaaggccataaattg,luxMutPF
caatttatggccttcaaaatccagattattcggcaattcattaatg,luxMutPR

Changed base 2122 from A to G.

Used Phusion mix, applied the following protocol:
Knight:Site-directed_mutagenesis/Single_site