User:Spenser Skates/Notebook/pTKX luciferase biobrick/2008/04/16

Project name	Main project page Previous entry      Next entry
Removal of XbaI site by site-directed mutagenesis Performed site directed mutagenesis using the following primers for PCR in order to remove the XbaI site. cattaatgaattgccgaataatctggattttgaaggccataaattg,luxMutPF caatttatggccttcaaaatccagattattcggcaattcattaatg,luxMutPR Changed base 2122 from A to G. Used Phusion mix, applied the following protocol: Knight:Site-directed_mutagenesis/Single_site