Characterization B: Expression of PHIX174 promoters fused to UTR1-deGFP.
- From yesterday's ligation, only a few colonies on the NC background, with even fewer in the backbone + linker ligation.
- Determined problem. Linker used was "SphI-PA-NcoI," when the design file clearly shows that the linker is "SphI-PA-NheI." So incompatible backbone was used with this linker.
- Repeated ligation with correct backbone (~4 hr reaction time).
- 0.5 μL 15nM pBEST-SphI//NheI-deGFP-T500
- 5 μL 100nM SphI-PA-NheI
- Ratio = 1:66
- Negative control = -linker
- Transformed 2.5 μL ligation product into JM109.
Characterization C: Expression of PHIX174 promoters fused to UTRX-deGFP.
- From yesterday's ligation, only a few colonies on the NC background, with even fewer in the backbone + linker ligation.
- Determined problem. Linker used was "SphI-PA-UTRA-NheI," when the design file clearly shows that the linker is "SphI-PA-UTRA-NcoI." So incompatible backbone was used with this linker.
- Repeated ligation with correct backbone (~4 hr reaction time).
- 0.5 μL 16nM pBEST-SphI//NcoI-deGFP-T500
- 5 μL 100nM SphI-PA-UTRA-NcoI
- Ratio = 1:66
- Negative control = -linker
- Transformed 2.5 μL ligation product into JM109.
Hypothesis 2: Gene L is necessary for phage propagation.
- Since I know whole plasmid PCR works in principle, I need to determine whether or not it is the ΦX174 template or the primers, the only other components of the reactoin, that is the problem.
- First, I will attack the template, since I have amplified portions of it in the past. Therefore, I performed standard PCR as a positive control to determine whether or not the template is working.
- ΦX174 template concentration (final) = 0.1 nM
- Primer concentration (final) = 1 μM primer (each)
- Sense primer = GTCGACGCATGCATGACTCGCAAGGTTAGTGC
- Antisense primer = AACATACAATTGGGAGGGTGT
- TH = 58 °C
- N cycles = 36
- Amplicon = SalI-SphI-PL-L-PA-MfeI (282bp, 12bp SalI-SphI upstream primer extension)
- Negative control = -template
- Gel electrophoresis results:
- NC = nothing (nothing expected)
- PCR = ~≤ 300 bp (282bp expected)
- Conclusion: template functions for PCR. Therefore, the problem with the whole plasmid PCR reaction is the primers (or perhaps the annealing temperature).
|
PHIX174 Cell Free Expression
Main project page
Previous entry Next entry
