User:Sean P Corum/Notebook/PHIX174 Cell Free/2012/07/07

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png PHIX174 Cell Free Expression Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Characterization B: Expression of PHIX174 promoters fused to UTR1-deGFP.

  • From yesterday's ligation, only a few colonies on the NC background, with even fewer in the backbone + linker ligation.
  • Determined problem. Linker used was "SphI-PA-NcoI," when the design file clearly shows that the linker is "SphI-PA-NheI." So incompatible backbone was used with this linker.
  • Repeated ligation with correct backbone (~4 hr reaction time).
    • 0.5 μL 15nM pBEST-SphI//NheI-deGFP-T500
    • 5 μL 100nM SphI-PA-NheI
    • Ratio = 1:66
    • Negative control = -linker
    • Transformed 2.5 μL ligation product into JM109.

Characterization C: Expression of PHIX174 promoters fused to UTRX-deGFP.

  • From yesterday's ligation, only a few colonies on the NC background, with even fewer in the backbone + linker ligation.
  • Determined problem. Linker used was "SphI-PA-UTRA-NheI," when the design file clearly shows that the linker is "SphI-PA-UTRA-NcoI." So incompatible backbone was used with this linker.
  • Repeated ligation with correct backbone (~4 hr reaction time).
    • 0.5 μL 16nM pBEST-SphI//NcoI-deGFP-T500
    • 5 μL 100nM SphI-PA-UTRA-NcoI
    • Ratio = 1:66
    • Negative control = -linker
    • Transformed 2.5 μL ligation product into JM109.

Hypothesis 2: Gene L is necessary for phage propagation.

  • Since I know whole plasmid PCR works in principle, I need to determine whether or not it is the ΦX174 template or the primers, the only other components of the reactoin, that is the problem.
  • First, I will attack the template, since I have amplified portions of it in the past. Therefore, I performed standard PCR as a positive control to determine whether or not the template is working.
    • ΦX174 template concentration (final) = 0.1 nM
    • Primer concentration (final) = 1 μM primer (each)
    • Sense primer = GTCGACGCATGCATGACTCGCAAGGTTAGTGC
    • Antisense primer = AACATACAATTGGGAGGGTGT
    • TH = 58 °C
    • N cycles = 36
    • Amplicon = SalI-SphI-PL-L-PA-MfeI (282bp, 12bp SalI-SphI upstream primer extension)
    • Negative control = -template
  • Gel electrophoresis results:
    • NC = nothing (nothing expected)
    • PCR = ~≤ 300 bp (282bp expected)
  • Conclusion: template functions for PCR. Therefore, the problem with the whole plasmid PCR reaction is the primers (or perhaps the annealing temperature).