User:Sarah Jo Sleiman/Notebook/Biology 210 at AU

From OpenWetWare
Jump to navigationJump to search

INSTAGRAM FOR LAB PHOTOS: instagram.com/bio210_sjs

Lab Day: 3/4/2016 Lab Entry 8: Last Day with Zebrafish!


Lab Day: 2/26/2016 Lab Entry 7: Zebrafish and Sequencing

The purpose of this week's lab was to continue examining the development of the zebrafish embryos, comparing the treatment and control groups. The focus was on the size, color, and health of the developing zebrafish. Those in the lab group went in on different days throughout the week up until March 4th, which was the last day for collecting zebrafish data. This data can be viewed through this link: https://docs.google.com/document/d/1zAPnS6hQ3O4nS7XYjTje3NSobay-4g08jLyCM8BTfwM/edit?pli=1 . Along with the collection of zebrafish data, data sequencing from transect 4 was also collected.

With the use of microscopes, we examined each of the 40 wells (20 from the treatment, 20 from the control) containing zebrafish embryos. At this point, a few were sickly, dead, or disintegrated. Those still alive were either very active or becoming sickly. The remaining zebrafish were fed 15 microliters of Brine Shrimp and the wells that appeared to be low were added to with the respected solution (water in the control and metoprolol in the treatment). At this point, the embryos observed in the treatment group were developing rapidly, more so than those in the control.

DNA Sequencing from Transect Sequence 8: Pseudomonas putida Strain (98% match) NNNNNNNNNNNNNNNNGNNATGCAGTCGAGCGGATGAGAAGAGCTTGCTCTTCGATTCAGCGGCGGACGGGTGAGTAATG CCTAGGAATCTGCCTGGTAGTGGGGGACAACGTTTCGAAAGGAACGCTAATACCGCATACGTCCTACGGGAGAAAGCAGG GGACCTTCGGGCCTTGCGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTGGTGGGGTAATGGCTCACCAAGGCGACGA TCCGTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGG AATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAG TTGGGAGGAAGGGCAGTAAGCGAATACCTTGCTGTTTTGACGTTACCGACAGAATAAGCACCGGCTAACTCTGTGCCAGC AGCCGCGGTAATACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTTGAA TGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTGGCAAGCTAGAGTACGGTAGAGGGTGGGTGGAATTTCC TGTGTAGCGGTGAAATGCGTAGATATAGGAAGGAACACCAGTGGCGAAGGCGACCACCTGGACTGATACTGACACTGAGG TGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTANCGATGTCAACTAGCCGTTGGAATCCT TGAGATTTTAGTGGCGCAGCTACGCATTAAGTTGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCANTGAATTGAC GGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGANAACCTTACCNNCCTTGACATGCAGANAAC TTTCTAGAGATAGATTGGTGCCTTCNGGAACTCTGACACNNTGCTGCATGGCTGTCGTCAGCTCGTGTCNTGAGATGTTG GGNNAGTCCCGTANNAGCGCAACCCNTGTCCNTANTTACCAGCNCGTTATGGTGGGNACNNNTANNNNACTNCN

Sequence 9: Pseudomonas sp. Strain (43% match) NNNNNNNNNNGNNNNNNGNNNTGCAGTCGAGCGGTAGANCAGNGGCATGTGTTGTCTCTGGGTAGACGGCGGACGGGTGA GTAATGCCTGTGAATCTGCCTGGTNGTGGGGGAGGGANATCTGAAGCGGACGCTAATACCGCCCACGTCCTACCGTAGAA AGCAAGGGAGCTTCNGGCCTTGCGCTAGCNAATGAACCTGCGTCGAATTAANTAGTTGGTGAGGGAAGGGCTGACCCAGG CAACNATCCATACCTGGTCTGACAGGAAGATCGACCACACTGGAACTGACACACGGNCCGNACTCATACCGGAGGCAGCA GTGGGGAATATTGAACGATGGGNGGAAGCCTGATCCAGCCATGCCTGGTGTGTGAATAAGGACTTCNGATTGTAAAGCAC TTTCATTCAGGAGGAAGGATTGTATTTTGATACTCAACCACTTTGATTTTCCTTACTCAAAAAACAACCGCCAACTCTGT CCCTGCCACCACCCNCATTAATACGGAGGGTGCGTTAATTANAATTAATTACTGGNCATCAAGCGCACGCAGGTCGTCTG TTTAGATGTAAAAGAAATCCCCNGNCTCANNCTGACTAACTNCNNTCCAAACTGNCNAGNTTAGTNNNNNNNAGGGGGGG TANTAATTNCNNGTGTATCGNTGAAATGCGTATANATCTGGANGAATACNNNTGNCGAAGGCNCCCCCCTNNACAAAGAC NCACNCTCANGTGCGANAGCGTGNGGAACAAACANGAGTANATACCCTGGTANTCCNCGCCNNNNACGATATCTACNTNT TNGTTGTTNTCNTGAGGANTNNCNNCCCCANCTCACNCATTNNNTCGACCNCCTGNGGANNNCNGCNCNCGAGGTTAANN NCTCNNATNTNNTTGANNNNNGCCCNCNCNANCGGNGCGAGNNNGTNTTTTTNNTTCTNATNCNNCNANNAACANNNNTA CCNNCTCTNNTNNNCCNNNNCTANTTNNAANNNATAANNACNNNNNTTNNNNNNCNNNGNNNACANNTNCNTNNNGGNNN NNNANCNNCNNNNNNNNTNNNNNNNNNNTTNNGNNNNNNNAANNNNNNNANNNNTNNNNNTNNTNNCNNNNNTGNNNNNT TNGNNNNNNNNANANNTNNNNNNNNNNNNCNCNNNNNNGNNNNNNNN

Lab Day: 2/19/2016 Lab Entry 6 Zebrafish: Entry 1

This week's lab focused on the beginning of the Zebrafish experiment from which we observed the development of zebrafish embryos through the manipulation of the environment they developed in. We took two petri dishes filled with Deer Park Water and collected 20 embryos in each dish. One dish was set as control (water) while the other dish was set as treatment (metoprolol). The first dish was set aside as a 24 well rack was filled with the control (2-3 µL), but only 20 of those wells were used. After filling the wells with water, each embryo from the control petri dish were transferred into each of those 20 wells with a small pipette that was cut as to not harm or damage the embryo. The second dish was then set aside as another 24 well rack was filled with 2-3 µL of what we believed was an estrogen mimic known as metoprolol, yet we later learned was rather an androgen agonist rather than an estrogen agonist. We took the other 20 embryos and transferred them into those wells with the androgen agonist. Over the course of the next week, each team member went in to observe and record the development and health of each embryo based off of the observations from a microscope. When I went in, I observed that two of the embryos were missing and one looked very sickly and ended up being dead. Those observed in the treatment wells were observed to be moving along faster in development, being more so in the Prim-16/22, high pec, long pec, pec-fin stage range with a few possible protruding mouth developments. However, those in the control were observed to be in somite stage with a few prim stages. The observations will continue into this week.

SJS


Lab Day: 2/12/2016 Entry 5

In this week's lab, we carefully broke down the components of the Berlese Funnel, pouring the top 10-15 µL from the tube filled with ethanol and possible organisms into a petri dish, while the rest of the liquid mixture was poured into another petri dish. Using a dissecting microscope, we observed the organisms that were collected from the Berlese Funnel. Using a dichotomous key, we identified 5 invertebrates nematoda enoplia, diplopoda arthripod (millipede), nematoda enoplia, arthripoda insecta (collembola), and a nematoda enoplia. It is interesting to note that we did find several nematoda enoplia, but at the time that was all that we could find and the organisms continued to appear and were ultimately the most common in our leaf litter. The two samples differed in the sense that there were larger organisms found in the bottom of the Berlese Funnel, while the organisms found in the top did not have a variety, but rather a consistency in one organism. Overall, what we found in our transect is unique in the sense of the types of organisms found and the consistency from which they were found in amount.


SJS

Lab Day: 2/5/2016 Entry 4

In this week's lab, we re-visited our transects and chose five plants to use and observe under a microscope. In addition, we collected dead leaves and plant matter for a leaf litter in order to construct a Berlese Funnel for collecting invertebrates for next week's lab. The purpose of both of these procedures was to identify types of plants and fungi in our transect.

Plant Descriptions The five plants we collected were somewhat diverse from each other. The first plant was near the West end of our transect near a bench. It consisted of white flower bulbs that faced downwards on a green stem. This plant reproduced through pollination. Since it is classified as an angiosperm, it goes through vascularization and contains specialized structures such as the stomata. The next plant was a thick patch of bright, dark green grass that was located near a tree in the Northeast part of our transect. These grasslike structures were short and stout. The third plant found was located near the rock path on the East side of the transect. This plant in particular almost resembled a four leaf clover. However, it contained many ridges in the leaflets and was also very veiny with a dull green color. The leaflets varied from 5-6 rather than 4 like clovers. Another plant we found contained three leaflets. This veiny purple-stemmed, dark green plant was located near the rock path on the East side of the transect. Last, but not least, we found a flower plant located near a tree on the North East side. It was pink and was beginning to bud in a bush (until we clipped and collected it). It reproduces through pollination as well. This flower is also considered an angiosperm and goes through vascularization as well as containing a stomata. All of the plants collected have vascularization and have roots.

We did not collect any seeds in our transect due to there being no observable ones available, but we can assume that the grass and leafed plants reproduce by seeds, while the flower we collected does so by pollination.

Fungi Sporangia are small, black round structures that become black as they mature. They are important because they contain spores produced by mitosis, which are released and spread when sporangia open. Although we did not observe any, in class we learned about one in particular known as the Basidiomycota mushroom. Overall, fungi are important to daily life since they are decomposers and rid of dead organisms that take space on the planet. The mushroom mentioned is known to be very common.

I will be using an Instagram page to depict pictures since Open Wet Ware has failed to upload the ones I was attempting to show.

SJS

Lab Day: 1/29/16 Entry 3

Hay Infusion Observations Our Hay Infusion consisted of rocks, twigs, leaves, grass, soil, and flowers. After two weeks, we observed it a second time after being diluted in dried milk and deer park water. The smell has gotten more foul and rotten. We suspect that it will continue to get worse and more moldy not only due to the time left in a jar, but also due to any bacteria left in the jar.

'Serial Dilutions (Table 1)

Procedure II: Antibiotic Resistance To prepare the serial dilution, we took 10 mL of broth and pipetted into four tubes. 100 µL of the Hay Infusion culture was micropipettes into the tube labeled 10^-2 and shaken. 100 µL of that solution was pipetted into the tube labeled 10^-4. After shaken, 100 µL of that solution was pipetted into the tube labeled 10^-6. Finally, 100 µL of that solution after shaken was pipetted into the tube labeled 10^-8. 8 Agar plates were obtained, all labeled either 10^-3, 10^-5, 10^-7, or 10^-8. Four of which were tetracycline positive and four of which were tetracycline negative. Next, 100 µL from the tube labeled 10^-2 were pipetted onto and spread onto the blood agar plates labeled 10^-3 that were both tet + and txt -. This was repeated transferring 100 µL from 10^-4 to 10^-5 (nutrient agar), 10^-6 to 10^-7 (nutrient agar), and 10^-8 to 10^-9 (blood agar). After being kept at room temperature for a week, we observed the colonies and noticed that without antibiotics, there were more bacteria on agar plates. There were only 1 colony observed on one of the plates and a lot of colonies on others (as shown from the table above and the pictures below). The blood agar displayed a foul smell and more tiny colonies than any of the other agar plates. In general specific bacteria that are sensitive to tetracycline include Chlamydia, Mycoplasma, and Rickettsia.

File:Pl1.jpg File:Pl2.jpg File:Pl3.jpg File:Pl4.jpg File:Pl5.jpg File:Pl6.jpg File:Pl7.jpg File:Pl8.jpg

Bacteria Cell Morphology Observations Wet Mounts and Gram Stains were made in order to observe the organisms from the serial dilutions. In order to make a wet mount, we sterilized a loop over a flame to then scoop up a sample of the colony from the agar plates (shown above). After creating a slide they were observed with a microscope. The Gram Stain was created by sterilizing a loop over a flame and scraping samples from the colonies on the agar plates and placing water on the slides. Afterwards, the water was evaporated by putting the slide over the flame from the Bunsen burner. Crystal violet was then placed on the slide for one minute and rinsed off with water. Iodine mordant was then placed on the side for one minute and rinsed off with water. To clean the stain, rubbing alcohol washed the slide for 10-20 seconds and then rinsed. Safranin stain was placed on the slide for 20-30 seconds and then rinsed with water. After blotting the slide with the kimwipe, the slide was ready to be viewed under the microscope. Below is the wet mount microscope pictures, a table describing not only the colony description of four of the plates that showed the most activity, but also the cell description after being observed under the microscope along with pictures from the microscope.

Wet Mount Microscope Pictures

10^-5 Tet- File:105n.jpg

10^-5 Tet+ File:105p.jpg

10^-3 Tet - File:103n.jpg

10^-3 Tet + File:103p.jpg


Colony Plates: 10^-5 tet + and 10^-5 tet - File:5tet+.jpg File:5tet-.jpg

Colony plates: 10^-3 tet + and 10^-3 tet - File:3tet+.jpg File:3tet-.jpg


The last part of the lab we set up was a PCR to identify the species found in our Hay Infusion. The agarose gel will occur during the next lab.

SJS


Lab Day: 1/22/16 Entry 2

After a week, my lab partners and I observed our Hay Infusion. It was not as diluted as other groups' jars; it contained a very dark brown color. However, similar to many other groups, our jar had a very foul smell. The dilution itself consisted of 10.87 g of samples from our Transect, 0.1 g of dried milk, and 500 mL of DeerPark water. We then took samples from the Hay Infusion itself in order to observe any protists or algae present under a microscope. The layers we chose to pull our samples from in order to make wet mounts were the bottom later and the top later since they would seem to have very different organisms. Using the dichotomous key, we were able to identify a few of the organisms we saw through the microscope. The organisms we found in the bottom zone consisted of Stentor, Colpidium, and Phylum chlorophyta (green algae). In the top zone, Blepharisma, Arcella, and Amoeba were found. The Stentor was a bluish green color and appeared to having an elongated, trumpeted body shape. The Colpidium was caught moving on video. Moving fast across the slide, Colpidium had a round shaped, tiny body with a hook like mouth. The green algae was similar to an Arcella in the round shape, however, it was noticeably green and did not have any globs around it or the brown color like the Arcella we identified in the top zone. Blepharisma appeared as the color purple from the slide and is quite similar to the Colpidium in shape. Lastly, we found an Amoeba that would move occasionally but almost "creeped" across the slide. The size of the Amoeba was not big whatsoever. At the end of lab, we prepared and plated Serial Dilutions for next week's lab from the Hay Infusion. We took samples from the Hay Infusion and pipetted them into sterile broth, which had the dilutions of 10^-2, 10^-4, 10^-6, and 10^-8. Afterwards, we micropipetted the Culture onto four nutrient agar plates and four nutrient agar plus tetracycline plates, which all had different dilutions (i.e. 10^-3, 10^-5, 10^-7, and 10^-9). We did this so that in next week's lab we will be able to see the bacteria from the Hay Infusion divide to form colonies on the agar plates.

Initial Recordings:

Ocular View of Slide:

Error creating thumbnail: File missing

Colpidium:


SJS



Sarah Sleiman Bio II Lab Section 8 January 15, 2016 Transect 4

The transect observed is located near Gray Hall at American University. It consists of abiotic life (non-living things) and biotic life (living things). The abiotic life observed included 6 benches, several red wires weaving in and out of the soil, rocks (surrounding water and used as a pathway), a statue, a sign, a bucket, a plaque, nets, a few sprinklers, and a sewer opening. The biotic life consisted of numerous trees, bushes (both barren and flower-filled), grass (both dry and well watered), soil, leaves and acorns. Although there were no animals present when observing the transect itself, twigs at the bottom of the trees show possible signs of bird's collecting for nests. In addition, the many acorns, some broken and others in tact, are signs of squirrel presence.

After observing the transect, an aerial drawing was made to replicate such observations. In addition, samples (i.e. rocks, leaves, acorns, twigs, flowers, grass) from the transect itself were collected and taken back to the lab to conduct a Hay Infusion. Along with the 10.87 g sample, 0.1 g of dried milk and 500 mL of DeerPark water were combined in order to perform the Hay Infusion, which was shaken and left in the lab with the lid off over the course of a week.

Attached below are the aerial drawing of the transect, pictures taken from the transect site, and a picture of the Volvocine Line, which was conducted after the Hay Infusion was combined, based off of microscopic observations of Chlamydomonas, Gonium, and Volvox.

Error creating thumbnail: File missing Error creating thumbnail: File missing


SJS