User:Omar Choudary/Notebook/Omar Choudary CHEM-571 AU-2011/2012/2011/11/01

From OpenWetWare
Jump to: navigation, search
BDLlogo notext lr.png Chem-571 Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png


Objective

  • Perform gold nanoparticle(AuNP) synthesis as well as determine if acidity (lower pH) affects protein fiber aggregation.
  • Perform plasmid PCR experiment from 9/20 to mutate Green Fluorescent Protein (GFP) to include a cysteine residue after the enterokinase cleavage site.

Description

  • AuNP Synthesis: 15.5 μM Bovine Serum Albumin (BSA), 2.9 mM Chloroauric Acid (HAuCl4), 3 M Hydrochloric Acid (HCl), and H2O.

1. Tube 1 (in this specific order): 1 mL of BSA stock solution (15.5µM), 1 mL of HAuCl4 stock solution (2.9mM), 8 mL water.

2. Tube 2 (in this specific order): 1 mL of HCl stock solution (3M), 1 mL of BSA stock solution (15.5µM), 8 mL water.

3. Placed in oven set at 80 degrees Celsius, and removed every 30 minutes for 10 minutes over the course of 2 hours.


  • PCR: Same protocol as experiment performed 9/20, except with different primers.

1. Added 5 µL of 10X Pfu Buffer, 1 µL of each primer, 1 µL of DNA sample, 1 µL of dNTP mix, 40 µL of water, 1 µL of Pfu Turbo, 50 µL of wax solution to tube.

2. Placed in thermocycler with the following temperature cycling program:

A. 30 sec at 95°C

B. 30 sec at 60°C

C. 7 min at 72°C

D. Repeat these three steps 19 times

E. 10 min at 72°C

F. Leave overnight at 4°C

Data

  • Tube 1 was a clear solution with grey and dark purple protein fibers.

OC-11-1-1.jpg


  • Tube 2 was a clear solution with no visible protein fibers.

Notes

  • Tube 1 molar ratio of Au/BSA - 187.1
  • Tube 2 molar ratio of Au/BSA - 0
  • Observations from Tube 2 indicate that lowering pH does not affect protein fiber aggregation.
  • Forward primer: 5'TACGACGATGACGATAAGTGTCGATGGGGATCCGAATTC 3'
  • Reverse primer: 5'GAATTCGGATCCCCATCGACACTTATCGTCATCGTCGTA 3'