User:Omar Choudary/Notebook/Omar Choudary CHEM-571 AU-2011/2012/2011/11/01

Chem-571

Main project page Previous entry      Next entry

Objective Perform gold nanoparticle(AuNP) synthesis as well as determine if acidity (lower pH) affects protein fiber aggregation. Perform plasmid PCR experiment from 9/20 to mutate Green Fluorescent Protein (GFP) to include a cysteine residue after the enterokinase cleavage site. Description AuNP Synthesis: 15.5 μM Bovine Serum Albumin (BSA), 2.9 mM Chloroauric Acid (HAuCl4), 3 M Hydrochloric Acid (HCl), and H2O. 1. Tube 1 (in this specific order): 1 mL of BSA stock solution (15.5µM), 1 mL of HAuCl4 stock solution (2.9mM), 8 mL water. 2. Tube 2 (in this specific order): 1 mL of HCl stock solution (3M), 1 mL of BSA stock solution (15.5µM), 8 mL water. 3. Placed in oven set at 80 degrees Celsius, and removed every 30 minutes for 10 minutes over the course of 2 hours. PCR: Same protocol as experiment performed 9/20, except with different primers. 1. Added 5 µL of 10X Pfu Buffer, 1 µL of each primer, 1 µL of DNA sample, 1 µL of dNTP mix, 40 µL of water, 1 µL of Pfu Turbo, 50 µL of wax solution to tube. 2. Placed in thermocycler with the following temperature cycling program: A. 30 sec at 95°C B. 30 sec at 60°C C. 7 min at 72°C D. Repeat these three steps 19 times E. 10 min at 72°C F. Leave overnight at 4°C Data Tube 1 was a clear solution with grey and dark purple protein fibers. Tube 2 was a clear solution with no visible protein fibers. Notes Tube 1 molar ratio of Au/BSA - 187.1 Tube 2 molar ratio of Au/BSA - 0 Observations from Tube 2 indicate that lowering pH does not affect protein fiber aggregation. Forward primer: 5'TACGACGATGACGATAAGTGTCGATGGGGATCCGAATTC 3' Reverse primer: 5'GAATTCGGATCCCCATCGACACTTATCGTCATCGTCGTA 3'