User:Mbennie/Notebook/Oligos/Myc Tag-F

From OpenWetWare
Jump to: navigation, search

Sequence: gtttcttcgaattcgcggccgcttctagaggtgaacagaagcttatttcggaagaggac

Binding site: 24 bp

Predicted Tm: 54.7C

Received: 8/16/2007

  • Resuspended at 50uM with 310.6ul of TE