User:Mbennie/Notebook/Oligos/Mut Pst1b-R

From OpenWetWare
Jump to: navigation, search

Sequence: gctcttcaggcagataacaagggttttacggtaaggt

Binding site: 26 bp

Predicted Tm: 54.3C

Received: 7/31/2007

  • Resuspended at 50uM with 486ul of TE