User:Mbennie/Notebook/Oligos/Mut Pst1a-F

From OpenWetWare
Jump to: navigation, search

Sequence: gctcttcagccgattacaagttgggtgacgacag

Binding site: 23 bp

Predicted Tm: 52.9C

Received: 7/31/2007

  • Resuspended at 50uM with 402ul of TE