User:Mbennie/Notebook/Oligos/Mut2 Pst1b-F

From OpenWetWare
Jump to: navigation, search

Sequence: gctcttcagctgcttactttgccaattatggcaa

Binding site: 23 bp

Predicted Tm: 55.2C

Received: 8/15/2007

  • Resuspended at 50uM with 477.2ul of TE