User:Mbennie/Notebook/Oligos/IgAss-F

From OpenWetWare
Jump to: navigation, search

Sequence: gtttcttcgaattcgcggccgcttctagatgaaagccaaacgttttaaaattaacg

Binding site: 28 bp

Predicted Tm: 58.3C

Received: 8/1/2007

  • Resuspended at 50uM with 384ul of TE