
From OpenWetWare
Jump to: navigation, search

Sequence: gtttcttcctgcagcggccgctactagtattattagaaacgaatctgtattttaatttgtcc

Binding site: 30 bp

Predicted Tm: 55.5C

Received: 8/1/2007

  • Resuspended at 50uM with 566ul of TE