User:Mbennie/Notebook/Oligos/FLAG Tag-R

From OpenWetWare
Jump to: navigation, search

Sequence: gtttcttcctgcagcggccgctactagtacccttgtcatcgtcatccttgtaatca

Binding site: 25 bp

Predicted Tm: 54.9C

Received: 8/16/2007

  • Resuspended at 50uM with 339.2ul of TE