User:Mbennie/Notebook/Oligos/6His Tag-F

From OpenWetWare
Jump to: navigation, search

Sequence: gtttcttcgaattcgcggccgcttctagaggtcatcaccatcaccatcacg

Binding site: 21 bp

Predicted Tm: 53.1C

Received: 8/16/2007

  • Resuspended at 50uM with 410.8ul of TE