User:Maria Ines Goncalves/Notebook/Aulas Biologia Molecular 2010/2010/03/16

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Project name Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Sequenciação de DNA

Introdução

As sequências de genes e mRNAs com que temos vindo a trabalhar foram obtidas experimentalmente com base na técnica de sequênciação de DNA desenvolvida nos anos 70 por Fred Sanger.

A seguinte animação explica o funcionamento da técnica: Sanger sequencing

Actualmente utiliza-se uma versao mais moderna que recorre a DNA polimerases termoestáveis e nucleótidos fluorescents, permitindo maior sensibilidade e a leitura automática do resultado da sequênciação: Cycle sequencing

Note que o resultado de uma sequenciação é um electroferograma, que depois é convertido em "As, Cs, Gs e Ts" por um programa informático.


Questões

  • O que é necessário para fazer uma reacção de sequenciação?

É necessário a cadeia de DNA a sequenciar (DNA template), um primer (que é complementar à sequência de DNA), DNA polimerase (enzima) e os 4 desoxinucleótidos - dNTP (A, T, C e G). À mistura também se adiciona outro tipo de nucleótidos, didesoxinucleótidos (ddNTP)


  • Que cadeia é sequenciada?

A cadeia sequenciada é a 5'->3' e as cadeias obtidas na sequenciação serão iguais a esta. O primer a utilizar deve ser complementar da cadeia molde (3´->5´), dado que a polimerização ocorre de 5'->3'.


  • Porque se diz que a sequenciação pelo método Sanger é uma sequenciação por terminação?

A síntese da cadeia não é continuada indefinitivamente pois a mistura contém pequenas quantidades de didesoxinucleótidos, que bloqueiam a elongação. Isto deve-se ao facto dos ddNTP terem um átomo de hidrogénio ligado ao carbono 3´, em vez de um grupo hidroxilo.


  • Porque motivo a sequenciação não termina no primeiro nucleótido de cada tipo?

A quantidade de dNTP é bastante maior do que a de ddNTP, o que leva a uma incorporação probabilística com vantagens dos dNTP, obtendo-se cadeias de diferentes comprimentos e com número considerável de nucleótidos.


  • Considere o seguinte electroferograma de uma reacção de sequenciação de um DNA purificado. Que problemas consegue observar e porque sucedem?

Podem existir problemas tanto ao nível da polimerização como ao nível da resoluação da electroforese. A capacidade de polimerizar fragmentos com mais de 350-400 nucleótidos é reduzida, o que é observado no electroferograma pela fraca intensidade dos picos. Além disto, os picos correspondentes aos fragmentos de menor e maior comprimento não têm uma boa resolução, porque na electroforese são devidamente delimitados.


2010 TP2 1.jpg

  • O segmento de DNA estudado nesta experiência tem 5 Kpb. Tendo em conta que apenas consegue determinar a sequência de 600-1000 nucleótidos em cada reacção de sequenciação, como dever proceder para analisar o fragmento completo?

Adicionando primers complementares a diferentes distâncias da cadeia. Quando na sequência estão porções desconhecidas, utiliza-se o final de uma cadeia polimerizada anteriormente para a construção do primer.


  • Na imagem seguinte está representada o resultado de uma sequênciação de uma região genómica variável (polimórfica) de 2 indivíduos distintos. Qual o genótipo de cada indivíduo?

2010 TP2 2.jpg T vermelho A verde G preto C azul

Ind. 1 - TCGTGTTCTATGATCATGAGGTCGCCG

Ind. 2 - TCGTGTTCTATGATC/GATGAGGTCGCCG -> heterozigotia



  • Suponha que queria sequenciar o gene e o mRNA da beta-globina. Como deveria proceder?

Para sequenciar o gene recorre-se a um procedimento semelhante ao analisado. Quanto à amostra biológica poderá ser de qualquer tecido uma vez que todas as células têm no genoma este gene. Para sequenciar o mRNA será necessário obter cDNA,uma vez que só este pode ser sequenciado e criar primers complementares ao mesmo. Quanto à amostra biológica o mais fácil será recolher uma amostra de sangue que contém as cálulas que expressam o gene em questão.


  • Considere os resultados da sequenciação discutida no Caso de Estudo 1.
  1. Que aspecto esperaria encontrar no electroferograma na região variável de cada indivíduo?
  2. Se tivesse apenas acesso aos resultados da sequenciação da Maria, seria capaz de definir o seu genótipo com rigor? Justifique.
  • Com base na sequência do gene da beta-globina disponível na última TP e as técnicas de análise de sequências que tem vindo a aprender identifique as regiões do gene em que se localizam as alterações pontuais encontradas.


Para pensar

  • Se a sequenciação obriga ao conhecimento prévio de um pequeno pedaço de sequência, como foi possível efectuar as primeiras sequenciações?


  • Que estratégias terão sido usadas para sequenciar os milhões de nucleótidos dos vários cromossomas do genoma humano?