User:Maria Ines Goncalves/Notebook/Aulas Biologia Molecular 2010/2010/03/09

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Project name Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Gene e mRNA

A sequência do genoma humano apresentada abaixo provém do cromossoma 11 e contém o gene da beta-globina:


CACACATATATATATATATTTTTTCTTTTCTTACCAGAAGGTTTTAATCCAAATAAGGAGAAGATATGCT TAGAACCGAGGTAGAGTTTTCATCCATTCTGTCCTGTAAGTATTTTGCATATTCTGGAGACGCAGGAAGA GATCCATCTACATATCCCAAAGCTGAATTATGGTAGACAAAACTCTTCCACTTTTAGTGCATCAACTTCT TATTTGTGTAATAAGAAAATTGGGAAAACGATCTTCAATATGCTTACCAAGCTGTGATTCCAAATATTAC GTAAATACACTTGCAAAGGAGGATGTTTTTAGTAGCAATTTGTACTGATGGTATGGGGCCAAGAGATATA TCTTAGAGGGAGGGCTGAGGGTTTGAAGTCCAACTCCTAAGCCAGTGCCAGAAGAGCCAAGGACAGGTAC GGCTGTCATCACTTAGACCTCACCCTGTGGAGCCACACCCTAGGGTTGGCCAATCTACTCCCAGGAGCAG GGAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTTACATTTGCTTCTGAC ACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGT TACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGG TTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTG ATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGA CCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAA GGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACC TTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGGTGAGTCTAT GGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGATAAGTAA CAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCAGGATCGTTTTAGT TTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCC GCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATT AAGTAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATT TGCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTA TGGGTTAAAGTGTAATGTTTTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAAT TTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCT TTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAAT TTCTGGGTTAAGGCAATAGCAATATCTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAG AGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGG CTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCACAG CTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGG CTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCT TGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAA GGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAATGATGTATTTAAATTAT TTCTGAATATTTTACTAAAAAGGGAATGTGG


A seguinte sequência corresponde ao mRNA da beta-globina:

ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGA GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC AGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATG CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGC TCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT CCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAAAA AAAAAAAAA



  • Que diferenças encontra e qual a sua origem?

Há porções do DNA que não são transcritas pois devem corresponder a intrões que não surgem na molécula de mRNA devido à ocorrência de splicing. A sequência de mRNA obtida corresponde aos exões. Outra diferença é a adição de vários nucleótidos de adenina à molécula de mRNA, fenómeno associado à finalização da transcrição.


  • Onde se inicia a transcrição e porquê?

Inicia-se no nucleótido 546, 26 nucleótidos após a TATA box, que neste caso é incompleta (falta-lhe o primeiro T) mas que serve o propósito de promover o inicio da transcrição. Além disto, encontram-se antes da TATA box outros elementos que promovem e regulam a transcrição.


  • Experimente traduzir ambas as sequências (tradução online). O que sucede e que implicações tem para o processo de expressão génica?

No caso da tradução realizada a partir da sequência de DNA não seria obtida nenhuma proteína devido ao elevado número de codões Stop que surgem, mas mesmo que eventualmente fosse possível obter a proteína (em ambas as leituras é possível encontrar Met V H L) esta seria diferente devido ao quadro de leitura ser "desviado" por serem traduzidas zonas intrónicas, que no caso da tradução do mRNA não surgem. Adicionalmente, verifica-se na sequência de mRNA uma certa degenerescência que não é encontrada na de DNA. Ambas apresentam porções antes e após a sequência que não são traduzidas (UTR - Untranslated Region).


  • Se estivesse a comparar a sequência de um gene de E. coli e seu transcrito, que diferenças esperaria encontrar? E se fosse de S. cerevisiae (levedura)?

Em ambas as situações, as sequência de DNA e mRNA são semelhantes uma vez que não existem regiões que sofram splicing e acabem por não ser transcritas. Há uma correspondência directa entre o gene e o transcrito. São poucos os genes de bactérias e de levedura que tenham regiões intrónicas.


  • As bactérias e leveduras podem ser crescidas facilmente em grandes quantidades, o que permite a utilização destes organismos como "fábricas" de produção de proteínas. Se pretender utilizar estes organismos para produzir uma proteína humana, que aspectos terá de ter em consideração?

Como não reconhecem zonas intrónicas seria necessário fornecer uma molécula de DNA que apenas contivesse as regiões exónicas, ou seja, a molécula de DNA complementar ao transcrito. Ter o cuidado de criar uma molécula associada a um promotor reconhecido pela bactéria ou levedura para que o gene seja transcrito. As UTR também podem não estar presentes e serem substituídas por sequência melhor reconhecidas pelos microorganismos em questão.