03/19/15
- Gal4DB fusions - new strategy
- Plasmid preps - overnight cultures
Gal4DB fusion - new strategy
- Build entire constructs via LCR using these as parts...
- MV10 - XbaI-cut, contains CMV promoter, XabI, and NLS-6his-stop
- Gal4DB-mCh - 1170 bp - PCR from KAH228, 5'p oligos
- Activation Domain - 159-4428 bp - PCR from cDNA, 5'p oligos
- Next step - order oligos
- Gal4DB f / 5'p, 5'-atgaagctactgtcttctat
- mCh r / 5'p, 5'-cttgtacagctcgtccatgc
- LCRb_MV10_Gal4DB_rc, 5'-[tgcttgttcgatagaagacagtagcttcat][ctccatggtggcggcggg]
- LCRb_mCh_ATF2, 5'-[gtgctggaccaaatttcagtgtcatctc][cttgtacagctcgtccatgccg]
- LCRb_ATF2_MV10, 5'-[gtgtaccttgcgctttttcttggg][aggatcttcgttagctgctcttctcc]
- Note: Each [side] of the LCR bridge oligo should have a Tm of 60°C (de Kok 2014)
- The LCR oligos shown here are the reverse complement of the coding strand(s)
|
Karmella's BioBrick Cloning
Main project page
Previous entry Next entry
