User:Karmella Haynes/Notebook/BioBrick cloning/2015/03/19

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.pngKarmella's BioBrick Cloning Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

03/19/15

  • Gal4DB fusions - new strategy
  • Plasmid preps - overnight cultures

Gal4DB fusion - new strategy

  • Build entire constructs via LCR using these as parts...
    • MV10 - XbaI-cut, contains CMV promoter, XabI, and NLS-6his-stop
    • Gal4DB-mCh - 1170 bp - PCR from KAH228, 5'p oligos
    • Activation Domain - 159-4428 bp - PCR from cDNA, 5'p oligos
  • Next step - order oligos
    • Gal4DB f / 5'p, 5'-atgaagctactgtcttctat
    • mCh r / 5'p, 5'-cttgtacagctcgtccatgc
    • LCRb_MV10_Gal4DB_rc, 5'-[tgcttgttcgatagaagacagtagcttcat][ctccatggtggcggcggg]
    • LCRb_mCh_ATF2, 5'-[gtgctggaccaaatttcagtgtcatctc][cttgtacagctcgtccatgccg]
    • LCRb_ATF2_MV10, 5'-[gtgtaccttgcgctttttcttggg][aggatcttcgttagctgctcttctcc]
  • Note: Each [side] of the LCR bridge oligo should have a Tm of 60°C (de Kok 2014)
  • The LCR oligos shown here are the reverse complement of the coding strand(s)