User:Ines Sofia Silva Vieira/Notebook/Bio Molec - caderno/2010/04/20

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Project name Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

TP5

Proponha com detalhe adequado um procedimento experimental que permita a identificação das mutações presentes no gene da beta-globina na família do nosso caso de estudo.


Procedimento experimental

1. Recolha da amostra - esfregaço de células da mucosa, sangue...

  1. 2. Construção de primers com o auxílio do programa 'primer3'
 a.	LEFT primer: CATATTCTGGAGACGCAGGA
 b.	RIGHT primer: TGCTCAAGGCCCTTCATAAT
  1. Estes primers podem ser usados uma vez que cobrem a área de interesse(onde está presente a mutação).
  2. 3. Lise dos eritrócitos para obtenção do DNA
  3. 4. Preparação da mix para o PCR:

DNAtemplate, primers F e R, Taq pol, dNTPs, solução tampão e H20.

  1. 5. PCR
  2. 6. Electroforese com produto de PCR para verificar se a reacção de PCR correu conforme o esperado.
  1. 7. Purificação do DNA sequenciado para remover as sequências de primers.
  2. 8. Desenhar primers para a região mutada:
 a.	CATATTCTGGAGACGCAGGA (5’ → 3’)
 b.	TGTACACATATTGACCAAATCAGG (5’ → 3’)
 c.	ATGGGACGCTTGATGTTTTC (5’ → 3’)
 d.	GGCATAAAAGTCAGGGCAGA (5’ → 3’)
  1. 9. Mix para sequenciação:

DNA template, primers, DNA pol, dNTPs e ddNTPs.

  1. 10. Comparar os resultados obtidos com a sequência de uma base de dados(BLAST)

Este procedimento deve ser aplicado tanto aos pais como à própria Maria para que sejam identificadas (após comparação)as mutações.


Proponha com detalhe adequado um procedimento experimental que permita o estudo da expressão do gene da beta-globina na família do nosso caso de estudo.


Para estudar a expressão do gene partindo do mRNA de cada individuo, é possivel obter cDNA pela acção da transcriptase reversa (RT-PCR).O cDNA é analisado posteriormente quanto ao tamanho e composição da sequência sendo então por fim comparada com sequências sem mutação
  1. 1. recolha da amostra biológica
  2. 2. lise dos eritrócitos para obtenção do RNA
  3. 3. Construção dos primers para RT PCR
  4. 4. mix para RT PCR:

RNA, MgCl2, dNTPs, transcriptase reversa, solução tampáo, Água e primers. (de seguida trata-se de uma reacção semelhante à anterior)

  1. 5. design de primers

LEFT primer: TCTGTCCACTCCTGATGCTG RIGHT primer: CTTTCTTGCCATGAGCCTTC

  1. 6.Realização de PCR (água, cDNA, TAQpol, primers, solução tampão, dNTPs)
  2. 7. electroforese
  3. 8. análise da sequenciação e comparação com a sequência dos pais e a sequência do BLAST
  4. 9. apresentação de resultados