User:Anthony Salvagno/Notebook/Research/2011/02/24/New pALS Reverse Primer
Quick Navigation: Pages by Category | List of All Pages | Protocols
Reason
I'm constantly getting two PCR products and the reason is because there is a sequence that matches my previous reverse primer by 67%. So I've checked through my pALS sequence and came up with another sequence that has a decent melting temp and has less matches. Here the next best match is 60% which is good enough (the forward primer has a 60% match too and that yields one product so this should work).
Sequence
- 5' - Digoxygenin - TTCGCTCCAAGCTGGGCTGTGTG
New Unzipping Adapter
I also put in for a new unzipping bottom adapter. The previous oligo was this:
Oligo #2: Bottom adapter 1a - Biotin Sequence 5' to 3': GAGCGGATXACTATACTACATTAGAATTCAGAC Modification: X = biotin-dT
So I am now replacing the X with a T and putting the biotin on the 5' end. If there is a nick, this should help with unzipping. I don't think there can not be a nick with the biotin here so we shall see.