User:Anthony Salvagno/Notebook/Research/2011/01/14/pBSTxi Primer Designing

Quick Navigation: Pages by Category | List of All Pages | Protocols

I have a 5kb vector and I want to make a 4.4kb PCR product with it. The sequence actually cloned in reverse, so we want the reverse primer to be dig labeled. I am using this site for primer design.

Results

Sequence Fasta File
Based on the results I got it looks like these primers are suitable:

• Forward (F50)
  • TGTGTCGCCCTTAGGTACGAACT
    • Steve Koch 16:42, 28 January 2011 (EST): Binds plasmid starting at 19

• Reverse (R4500)
  • CTGACTCGCTGCGCTCGGTC
    • Steve Koch 16:42, 28 January 2011 (EST): Binds bottom strand of plasmid ending at 4488

That makes the product 4.4kb and will yield a small fragment after digestion that can be removed via PCR cleanup (less than 100bp).

• New Reverse Primer (R4000)
  • TTCGCTCCAAGCTGGGCTGTGTG
    • Binds Bottom Strand ending at 4092. This will make the product 4kb instead of 4.4kb, but should yield one product instead of two like the primer above.