User:Anthony Salvagno/Notebook/Research/2010/01/13/Super Secret Ultra Project
Quick Navigation: Pages by Category | List of All Pages | Protocols
Normally I'm all open science, but recently I got put on a miniproject (as recently as yesterday) and out of respect for my collaborators I will not reveal anything about their project. However, I am still open and will discuss everything that I am doing.
The purpose of this project is to make a molecular ruler. Without having the ruler be floppy (by making it too long) it will have to be shorter than DNA's persistence length. This is why we are aiming for ~30nm by making a 100bp oligo. There are a few ways to do this and Koch and I came up with a few yesterday:
- PCR - this is the easiest because you just have to make 2 primers and let the process run its course.
- PCR, digest, ligation - This is similar to the unzipping construct method. I will PCR a fragment that has a RE cut site. Then I will digest the fragment. Then I will ligate an anneal set of oligos to make the fragment the proper length.
- Others
We are going to work on the first option for the time being, but if PCR doesn't work right then I will try option 2. Eventually something will work.
Designing Primers





I will be looking at notes from here.
I will use pBR322 as a starting point. I am looking to get a restriction site within the PCR fragment to give the users (mostly me) the option of cutting the fragment and making it smaller or longer if need be. I used the same Primer3 program and so far I got these results:
- Primers:
- Forward - ATCCGGTAACTATCGTCTTGAGTC
- Reverse - CCTACATACCTCGCTCTGCTAATC
- Hybridization Tm = -16.5C - that is a weird number but Figure 1 will demonstrate that it is a low melting temp.
- Self Hybridization:
- Forward Tm = 10.3C (figure 2)
- Reverse Tm = -1937C (figure 3)
- Complimentary to plasmid (see figures 4 for forward and 5 for reverse): Tm = 69C for both primers with perfectly hybridizing. The pictures don't demonstrate this for some reason but the bases are complimentary.
- Purely by luck there is a cut site for AlwNI. I've never used that before but it exists at position 2884. See figure below: