User:Alexander S Mikheyev/Notebook/rotifer alien genes/2009/11/18

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Alien genes Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

To do

  • restriction digest of A. vaga
  • amp AV genes


Primer sequences for A vaga alien genes identified by Gladyshev

  • the last two pairs amplify a 3kb intergenic fragment in one of the collinear pairs (hsp82 region)
Well Seq Name Seq Length Tm
A01 AV10158_F ATTAGCTTATGCAACGTCCAAAACA 25 63
A02 AV10158_R GCGGAGGATAATTTTCGTTGTTATC 25 63
A03 AV10153_F GAGCTGGTGAAATATTCATGATTCG 25 63
A04 AV10153_R ATAATCCCAAAATGCTTGTCCACTT 25 63
A05 AV10151_F TCACCCCAAGGAGCGTGTATAG 22 63.5
A06 AV10151_R GTGGTACTCTCTGGACACGCGATA 24 64.8
A07 AV10150_F GTGTGTATGCCTCTTTTCCATTCAC 25 63
A08 AV10150_R ACCATGTAAGGAGGGATTGAATCAT 25 63
A09 AV10140_F AAATGCATCATCAGCAATTAAAGGA 25 62.9
A10 AV10140_R CGTGTTTGATCTTTCGCTACATACC 25 63.1
A11 AV10134_F TCTATGGTAGCACTTGACGGAAGAC 25 62.9
A12 AV10134_R TTGGTCCAGCAATATAACAATCCAC 25 63.1
B01 AV10130_F TGGTGAAAATCAAGAAGGAGATGAA 25 63.2
B02 AV10130_R TTGACCAACAAATTTTCTACCAGGA 25 62.9
B03 AV10126_F AAAAGATGGTGCAATGTTAGCAAAA 25 63
B04 AV10126_R TCGTTCACGTATATCTCCTGGAAAA 25 63
B05 AV10123_F CAATATCGTTCAAGTCACCCTTCAC 25 63
B06 AV10123_R CTTGCCGAAAATCTATGTTATCACG 25 63
B07 AV10121_F ATCGATCTTTTATTCGCAAATCCAT 25 63
B08 AV10121_R TACCAACCGATTCTATGACGAAAGA 25 63
B09 AV10104_F ACACTTGAAGATCAACCTGCATTTC 25 62.8
B10 AV10104_R CGGAAATTAATTGTGCAGACATAGC 25 63
B11 AV10109_F ACAAGTGGTCGACAAGGTTTTTGTA 25 63.1
B12 AV10109_R CGGTTTTAAGTCTGGACTACCATCA 25 62.6
C01 AV10099_F TCCAAACGAGCAATACCATTAT 22 58.5
C02 AV10099_R GGTGGATCTGGTAATATTGCTT 22 57.2
C03 AV10098_F GCTGAAAGTTCTTCATCGAAATCAA 25 62.9
C04 AV10098_R GAAGAGCAAGTTGTGGATCATCATT 25 62.8
C05 AV10094_F ATGCTGGTCCATGTAAAATGACACT 25 63
C06 AV10094_R TTTCCATACTCCAAGCCAAATAGGT 25 63.1
C07 AV10092_F TCTTTCACAATTTCTTCCCAATCAA 25 63
C08 AV10092_R TTCATCACCGACTAATGATTGTCCT 25 63
C09 AV10089_F CCATTAGGAGCTCTTGTTTGTGCTA 25 63
C10 AV10089_R TGATCTAATGCATCTGCAAAATCCT 25 63.1
C11 AV10084_F GGTTGATTGTAATGATGTGGGAAAA 25 63
C12 AV10084_R TATTACATGTTAAATCCGCCCAATG 25 62.9
D01 AV10082_F GGTTCAACATGTAAACAATGTGCTG 25 62.7
D02 AV10082_R ACGTGGCAGCTTGACAAATACTATC 25 62.8
D03 AV10075_F GAACGATGAACGGTTTTAGTCCTCT 25 63
D04 AV10075_R CACCATATGCATCTCCACCAATAAT 25 63
D05 AV10071_F AGACCGCCAAATAAGCTTGTAACTC 25 63
D06 AV10071_R TAATGGCAAAAACCTCACGTTAGAA 25 63
D07 AV10045_F CAGGTGAAGATGGTCAAATACAAGG 25 63
D08 AV10045_R CAATGGATGGTGAAACGTGAATAAT 25 63
D09 AV10044_F ATCTGACCGATGTTCCAGTTGATAA 25 63
D10 AV10044_R TTCATCCTCGATATACACACGCTTT 25 63.1
D11 AV10043_F GGCTCGATCCACTTCTTTATCCTAA 25 63
D12 AV10043_R TTGAGTTAAATGACGAATCCATGCT 25 63
E01 AV10042_F ACACATACCGATTTTCACGTGCTAT 25 62.9
E02 AV10042_R AAGAAGATCACTATGACAGGCAACG 25 62.9
E03 AV10041_F TACCAATATTTGTGCTCCAGCTGTT 25 63.1
E04 AV10041_R ACCGTGGTGTATTCAAACTACCAGA 25 62.9
E05 AV10034_F CAGTCTTTCGAATCTTGGGTACAGA 25 62.9
E06 AV10034_R GCCGTATATGTTATGAGCTTGATCG 25 63
E07 AV10028_F TGATATTTATCCTCCGGCAAAGAAT 25 63
E08 AV10028_R GAAGAATATCTGCCAACTTCGGATT 25 62.9
E09 AV10027_F TACTACCATGTCCAGCTCCATTCAT 25 63
E10 AV10027_R ATATTATTTGCAATATGCGGCTCCT 25 63
E11 AV10025_F ATACCATCTCTTCAATGTCCACGAA 25 63
E12 AV10025_R ATATGGTACGTCACTGCCGAATAGA 25 63
F01 AV10016_F TTAAATCTGTGCAATACCACCATCC 25 63.1
F02 AV10016_R AGGACCAATCGATACAGCAATGTTA 25 62.9
F03 AV10011_F ATCACCTTGCACTGCTGTTACATTT 25 63.2
F04 AV10011_R TTGATTACAGGTGGTTCAGAGGGTA 25 63
F05 AV10007_F GTCCTCGTAGCAGATATCAATGGTG 25 63.1
F06 AV10007_R TTTAAATCACCCACATCAATCCAAG 25 63.1
F07 AV10002_F AATTGGATCTGTGGAAAGACATTCA 25 63
F08 AV10002_R CACTATAACACTTGCCCTTGAAACG 25 63.1
F09 5475_F CCNATNGAACCNTTTAGTCGATGTT 25 63.4 actually located at 27927
F10 8047_R CATTCNGCTTGTGTTGGATAGAGAC 25 63.2 actually located at 30146
F11 4220_F GCTCGTTCATCNCCACAAGATAAAT 25 64
F12 7822_R TTGTGTTGGATAGAGACCAAGNGA 24 62.5

looking for alien genes in vaga and ricciae

Reagents 1x conc. 40
h2o 7.75 - 230
10x 1 10x 40
dye 1 10x 40
dNTP 0.2 10 mM 8
Forward 1 5 uM ea
Taq 0.05 5 U/um 2
DNA 1 20 ng/ul 40
TOTAL 10 Cocktail per vial 9
  • 3m 94C (10s 94C; 3m 60C)x35
  • made 2 big 1% gels with 80ml TAE
  • loaded 2ul vaga followed by ricciae, left to right
Gid 2009-11-18 19hr 54min.jpg
Gid 2009-11-18 20hr 20min.jpg
  • maybe try an RsaI or Alu1 digest of long fragment for kicks
  • sequence AV10016 (6th from end) and AV10027 (8th from end)
    • both located on EU643475[accn]

trying restriction enzymes on A. vaga and ricciae

water 3 21
enzyme 1
NEB 2 1 7
DNA 5 35
BamHI EcoRI MspI Tsp509i
BamHi/MspI BamHI/Tsp509i EcoRI/MspI
  • 37C for 2 hours
  • vaga, then ricciae in the following order:
BamHI EcoRI MspI Tsp509i BamHi/MspI BamHI/Tsp509i EcoRI/MspI
Gid 2009-11-18 20hr 41min.jpg