Template:SBB10Project-37738
Welcome to your project page!
For each part listed, you should:
- Design oligos to make your part
- Write up proper construction files and put it on the Construction Files page
- Put your oligos on the Oligo Log page
- Put your parts into Clotho
You should design your construction strategy to put your part into plasmid vectorName-Bca1144 (Where vectorName is indicated for each part) using EcoRI and BamHI or just BamHI or BglII for EIPCR. The maps for all plasmids involved in our project can be downloaded here.
Several references have been provided to give you some background on the biology of your part.
Also, use the link above left to upload a picture of yourself, your name, and anything else you'd like.
Finally, you should create a notebook on the main page of the wiki
sbb30: O99 rep Gene
Source: pEC52 Target Sequence: aaaaacgattctgacgcattttttatgtttaccctggtgtttccttgtctttttgttttttttgcgtcagaaagcgactgagggtgttttaaggggtacgtacaacgggagttatggtaaatggatcgggttttcgggaaggttcgacaggatttgccgttgggtgtagtgtaagcgactgaaaaacaaacgcccctgaaattcgtgtctctccgccaagattgtcacgagaatacaggggcgaggtcggtcgataacctggaaggaatcgtaacacatgagcgccgcgcttcaatacttcgaagaaaatttaccccaccgtccctatcacacggatgatctcgcttttggtcttcgcatctccggcaaagggcgtgcgcttcttgcggggtacatccagcagaaccagcctcatgcgcagttctggctggtttttgacgttgaccgcgagggggctgcgattgactggagcgaccggaacgcccccgcgccgaacatcaccgtaaaaaatcccgtgaacggtcatgctcacctgctctatgcactcaacatcgccgtgagaaccgcgcctgatgcgtcggttaaggcactgaagtacgctgccgcgatagagcgtgcgctgtgtgagaaacttggtgcagatgtgaactacagcggactgatttgcaaaaatccgttccacctggaatggctggtgatggagtggcgcgaggaagcctataccctcgatgaactggctgattatctcgatttgagcgcctcagcgcgccgtagcatcgataaacattacgggatggggcgaaactgccacctgttcgaaatgacgcgcaaatgggcttacagggcgattcgtcagggctggcctgtattctcacaatggcttgatgccgtgatccagcgtgtcgaaatgtacaacgtatcgcttcccgttccgctttctccggcggaatgtcgggctattggcaagagcattgcgaaatacacgcacaggaacttcacgccggaaactttcgcacagtatgtggctgatacgcacacgccagaaattcaggctgcacgtggtcgcaagggcgggaaaattggaggtgctaagtctaagcgtggtgctgttgccacatctgcgcgaacgttgaaaccgtgggagactcttggaattagccgcgcctggtattaccaactgaaaaaacgaggtcttgtagagtag Vector: pBca9523 Short description: 5'UTR_repO99! Genbank reference: D30060.1 Family: Expressed CDS
This part encodes a Promoter.CDS composite part
Sometimes we make basic parts contain more than just a primitive element if there is reason to believe that some natural non-biobrick composition might be important for its activity. This is one of those instances. The part encodes a native promoter, rbs, and coding sequence, but no terminator.
Parts containing transcriptionally-competent constructs are often toxic to E. coli, so you may have some difficulty making this part. Make careful note in your notebook about the size distribution of colonies you get on your plates and the ratio of red to white colonies.
This part is associated with colE2 orthogonal replicon devices
The colE2 family of replicons encode two elements to enable replication of a circular DNA in E. coli: one is a protein called Rep and the other is a cis element, or more specifically the origin of replication, or just ori. Placing the ori in cis and a complete gene for producing Rep either in cis or in trans should allow replication of the DNA containing ori.
The purpose for these devices is to make additional conditional replicons that can be used in the same cell in E. coli. Ultimately, these will drive replication of the delivered DNAs in our systems allowing them to be cranked up to really high-copy in the cell. Our "Entry Vector" for this project, pBjk274, incidentally, replicates with a colE2-derived replicon. So, take special note of the instructions below as to which plasmid you should use for constructing your basic part.
You should read the following papers
References: PMID 17098894, PMID 8609624, and PMID 2841566.
sbb38: Pbad promoter
Source: pBjh1601CK-ig114
Vector: pBjk2741
Short description: {AraC-Pbad}
Family: Conditional Promoter
This part encodes the Pbad promoter and its regulatory protein, AraC. In the presence of the small molecule monosaccharide arabinose, Pbad generates RNA transcripts of downstream DNAs.
This part exists but requires an EcoRI/BamHI transfer
This part has already been made, but it's with the wrong vector for our assembly program. We need to move the part into a different plasmid. We'll do this with an EcoRI/BamHI transfer. The protocol describing this is here.
sbb37: Constitutive promoter
Source: pBca1100-Bca1152
Vector: pBjk2741
Short description: {Pcon-J23100}
Family: Constitutive Promoter
This part encodes the a constitutive promoter. It generates RNA transcripts of downstream DNAs "constitutively", or in other words, all the time regardless of whether you add some inducer chemical or not.
This part exists but requires an EcoRI/BamHI transfer
This part has already been made, but it's with the wrong vector for our assembly program. We need to move the part into a different plasmid. We'll do this with an EcoRI/BamHI transfer. The protocol describing this is here.