
From OpenWetWare
Jump to: navigation, search



PCR primer to insert BSA into IMPACT vectors

Tm = 69.5°C

Length = 32, LenPr = 15, MaxMM = 4

Priming to pCMV-SPORT6+BSA:

   CCCACAAAACTGGCACAATGAAGTGGGTGACT priming site at position 161 forward

Tm = 52.5°C. Tpcr = 51.3°C.



reverse PCR primer to insert BSA into IMPACT vectors

Tm = 71°C

Length = 29, LenPr = 15, MaxMM = 4

Priming to pCMV-SPORT6+BSA:

   TGGTTGTGTCGTGTTTAGGCTAAGGCTGT priming site at position 1956 reverse

Tm = 41.4°C. Tpcr = 47.9°C.



Quikchange primer to insert His8 tag at C-term of Chitin binding domain tag in IMPACT vectors

Tm = 80.4°C

Length = 56, LenPr = 8, MaxMM = 2

Correct priming to pTXB1:

GATGGGAACCATCCAACGTTCCTGCCTTGTGGCAGCTTCAA------------------------TGACTGCAGGAAGGG priming site at position 6570 forward

Tm = -0.8°C. Tpcr = 35.3°C.

Side-reaction priming to pTXB1:


Tm = 3.7°C. Tpcr = 36.6°C.



reverse Quikchange primer to insert His8 tag at C-term of Chitin binding domain tag in IMPACT vectors

Tm = 80.4°C

Length = 56, LenPr = 10, MaxMM = 2

Correct priming to pTXB1:

   TCGGGCTTTGTTAGCAGCCGGATCCCCTTCCTGCAGTCA------------------------TTGAAGCTGCCACAAGG priming site at position 6539 revers

Tm = 20.1°C. Tpcr = 41.6°C.

Side-reaction priming to pTXB1:


Tm = -3.6°C. Tpcr = 34.4°C.

Priming and melting/PCR temperatures are calculated using pDRAW