Lox plasmid sequence

From OpenWetWare
Jump to: navigation, search

[Back to Cre-Lox]

Lox plasmid sequence from the sequencing lab:

ATNNCANNNNTNGNTNGCNNANCTTTTTACCNNAANATNAGNGNATCC TACNNGANGNTTTTTATCNNAANTNTTTANNGTTTNTCNNTACCNNTT TTTNNGCAGNGNNANTTCGNGGCNGNTTNNANANTTTANGGNTANNTC ANNCNNAGGNATAGNGCTANCCANAANTNCNNANANNANACNTNANAC NAANTTNNCCNAGNCNNGCNCNNTCNCCNGANCCCNGGGNANATCCGN GCNCANCNCCTNGCCNNAAAAAAACANCANGGCCNCCAANGCCNGACN ANGCGNGNANACCNAANCCTTGCNCTCNTNCNCCANCCAGNANANAAN NGCCNCNNCTNCCCNNCNNCCCANGGTTNCCGGGNGNCCCNCNCNGNG NAANCGNANNANGGCNCNANCCCNNTTNACATANCNCNGTNCGGTNCG NAAACNGNAANGNAANTANCGNANGCNCNCNCNCANNNGGNCNAAANC NTTGACCNANCNCANNGGNGGNAACGGCNCAGNGNCGNTTTNCANGGN TNGTNANNANNGTTTTTTTGNACANNCNANNCCNCGGGCANCCAANCA NCANGCGCGTTACNCCGNGGGNCNATNTTTGATGTTANGNANCACCAN CNATNTTNCNCACCACCAACNATGTTACNCANCNGGNCANNCNCCCNA AAACAAANTTAGGNGNCTCANGTANGGGCATCNTTCGCACATGTAGGC TCGNCCCCNACNAANTCAAANCCANGCGGNCNGCTCTTGATCTTTTCG GNCGTGANTTCGNANACNTACCCACCTNCTCCCAACATCANCCGGACT CCNATTACCTCGGGAACTNGCNCCGTAGTAANACNTTCANCGCGCTNG CNGCCTNCNACAAANAANCGGTTGTNGNCGCTCTCGCGGCTTACNTNC TNCCCAANTTTGANCANCCGCNTAGTGAGNNCTATATCTANNAATCTC GCANTCCNCCGGCNNANNNCGGAGGGCAGGGNNATTGCCNCCGGCNCT CATCAATCCTCCTNCAAGCATGNANGCCAACGCGCTTGGTGCTTATGN NATCTACGGTGCAANCAAAATCACGGTNNACGATCCCGNNNNGGCCTN CTNTATNAAAGTTGNGNCATACGGAAGAGTTGATTGCNNTTNTAANNN CGACCAGTACCGCACCTAAGCATGCCGGNCTGACCTACNGTATACAGA AAAGCCGACTGACTCGGCTTCAATCGACAAAGTAACAGGAGGTACACA CACTNTGCAGAANNNTTGAAAATGC