Griffin:CRISPR

From OpenWetWare
Jump to navigationJump to search

CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) Nuclease

  • DSB : DNA double strand breaks undergo repair via error prone non-homologous end joining (NHEJ) or precision homology directed repair (HDR).
  • HDR : Rad51 family association with DSBs recruit accessory factors directing genomic recombination via homologous arms on an exogenous repair template.
  • Indel : Insertion deletion of bases in the genome of a cell.
  • NHEJ : Ku heterodimeric repair scaffolds associate with DSB ends. Stochastic insertions and deletions (Indel) introduction occurs when complimentary strands undergo micro-alignment dependent end resection / repair misalignment leading to frame shift. Useful for gene disrutpion. Observable within 12 hours at high efficiencies (<70%).
  • PAM : Target DNA sequence (protospacer) must be gRNA complimentary and contain a "protospacer adjacent motif" DNA sequence.
  • RGN : RNA guided Nuclease
  • saCas9 : 1053 aa Staphylococcus Aureus Cas9. PAM = NNGRRT
  • spCas9 : 1368 aa Streptococcus Pyogenes Cas9. PAM = N20-NGG. Versatile balance between PAM complexity (specificity) and construct size.
  • stCas9 : 1121 aa Streptococcus thermophilus (St1Cas9) PAM = NNAGAAW. 1388 aa St3Cas9 PAM = NGGNG
  • sgRNA : Fusion of ~20nt CRISPR RNA (crRNA) + ~60nt trans-activating RNA (tracRNA) simplifies RNA:Cas9 complex ratio from 2:1 -> 1:1, and improves editing rates relative to a dual RNA strategy. Targeted deletion utilizing 2+ sgRNA result in repair naive junctions by either sgRNA alone =higher % of Indel events. 1 sgRNA blunt end DSBs repair correct at a higher fidelity than 2+ sgRNA DSBs repair.

PCR

puromycin N-acetyltransferase

ATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACC GTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCG GTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAG ATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTG CTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCC GACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGA

RFP (Red Fluorescent Protein)

ATGAGCGAGCTGATCAAGGAGAACATGCACATGAAGCTGTACATGGAGGGCACCGTGAACAACCACCACTTCAAGTGCACATCCGAGGGCGAAGGCAAGCCCTACGAGG GCACCCAGACCATGAAGATCAAGGTGGTCGAGGGCGGCCCTCTCCCCTTCGCCTTCGACATCCTGGCTACCAGCTTCATGTACGGCAGCAAAGCCTTCATCAACCACAC CCAGGGCATCCCCGACTTCTTTAAGCAGTCCTTCCCTGAGGGCTTCACATGGGAGAGAATCACCACATACGAAGACGGGGGCGTGCTGACCGCTACCCAGGACACCAGC TTCCAGAACGGCTGCATCATCTACAACGTCAAGATCAACGGGGTGAACTTCCCATCCAACGGCCCTGTGATGCAGAAGAAAACACGCGGCTGGGAGGCCAACACCGAGA TGCTGTACCCCGCTGACGGCGGCCTGAGAGGCCACAGCCAGATGGCCCTGAAGCTCGTGGGCGGGGGCTACCTGCACTGCTCCTTCAAGACCACATACAGATCCAAGAA ACCCGCTAAGAACCTCAAGATGCCCGGCTTCCACTTCGTGGACCACAGACTGGAAAGAATCAAGGAGGCCGACAAAGAGACCTACGTCGAGCAGCACGAGATGGCTGTG GCCAAGTACTGCGACCTCCCTAGCAAACTGGGGCACAGATGA

GFP (Green Fluorescent Protein)

ATGGAGAGCGACGAGAGCGGCCTGCCCGCCATGGAGATCGAGTGCCGCATCACCGGCACCCTGAACGGCGTGGAGTTCGAGCTGGTGGGCGGCGGAGAGGGCACCCC CAAGCAGGGCCGCATGACCAACAAGATGAAGAGCACCAAAGGCGCCCTGACCTTCAGCCCCTACCTGCTGAGCCACGTGATGGGCTACGGCTTCTACCACTTCGGCACCT ACCCCAGCGGCTACGAGAACCCCTTCCTGCACGCCATCAACAACGGCGGCTACACCAACACCCGCATCGAGAAGTACGAGGACGGCGGCGTGCTGCACGTGAGCTTCA GCTACCGCTGCGAGGCCGGCCGCGTGATCGGCGACTTCAAGGTGGTGGGCACCGGCTTCCCCGAGGACAGCGTGATCTTCACCGACAAGATCATCCGCAGCAACGCCACC GTGGAGCACCTGCACCCCATGGGCGATAACGTGCTGGTGGGCAGCTTCGCCCGCACCTTCAGCCTGCGCGACGGCGGCTACCACAGCTTCGTGGTGGACAACCACATGCAC TTCAAGAGCGCCATCCACCCCAGCATCCTGCAGAACGGGGGCCCCATGTTCGCCTTCCGCCGCGTGGAGGAGCTGCACAGCAACACCGAGCTGGGCATCGTGGAGTACCA GCACGCCTTCAAGACCCCCATCGCCTTCGCCAGATCCCGCGCTCAGTCGTCCAATTCTGCCGTGGACGGCACCGCCGGACCCGGCTCCACCGGATCTCGC

Synergistic Activation Mediator

To initiate programmable DNA targeting, dCas9 coordinates RNA-duplex (crRNA+tracrRNA) scaffold. crRNA nucleotides 1-20 guide dCas9 adjacent to genomic protospacer adjacent motif(s) (PAM). Fusion of crRNA+tracrRNA generates a chimeric single guide (sgRNA).

Features

  • Recruitment of activators in trans
  • Insertion of protein binding RNA Aptamers (MS2) into sgRNA coordinates MCP
  • Heterogenous activator(s) (p65-HSF1)
  • Optimal upstream (-400)<->(-50) / (-200)<->(+1)

Components

  • dCas9: mutant Streptococcus (pyogenes) Cas9 nuclease with inactive catalytic domains utilized as a generic RNA-guided trans-modulator.
  • HSF1 : Heat Shock Factor 1 transcribes gene in response to heat stress.
  • MCP : MS2 coat protein binds each MS2 hairpin (1:1).
  • MS2 : Male specific bacteriophage-2 RNA hairpins. (repeat fusion to 3' sgRNA). noncoding scaffold.
  • p65 : NF-κB subunit.
  • RTA : Human herpes virus 8 (HHV-8) transactivator.
  • sgRNA: single guide RNA = chimeric Crispr RNA (crRNA) + transactivating crRNA (tracrRNA).
  • VP64 : VP16x4 / Herpes (alpha-TIF (trans-inducing factor) HHV-2 transactivator protein recruits OCT1 and HCF. (component of chimeric VP64-dCAS9).

CRISPR Nickase

Wild-type Cas9 Nuclease cleaves DNA via RuvC and HNH nuclease domains, that generate blunt end double strand breaks. Double nicking is achievable when Cas9 nickase (RuvC / HNH) complexing with appropriately spaced target sites mimic a double strand break via cooperative nicks.

  • Nickase HNH+ : HNH single nuclease domain cleaves DNA strand complementary to the RNA guide. Type 2 Streptococcus Cas9 contains 2 nuclease domains; RuvC / HNH
  • Nickase RuvC+ : RuvC 3 subdomain (RuvC1 @ N-terminal, RuvC2/3 flank HNH). Nuclease cleaves DNA strand non-complementary to the guide RNA. Type 2 Streptococcus Cas9 contains 2 nuclease domains; RuvC / HNH