Griffin:CRISPR

From OpenWetWare
Jump to navigationJump to search

CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) Cas Nuclease

CRISPR-Cas systems are adaptive RNA-programmed prokaryotic anti-[phage, virus, plasmid, transposon, integrative/conjugative elements, genomic island] defense, capable of supporting mammalian gene editing (genetic engineering) applications by virtue of rational CRISPR RNA (crRNA/∼20 bp) sequence design coupled with exogenous genetically modifiable Cas Nuclease expression.

The human GeCKO (Genome-Scale CRISPR Knock-Out) libraries target early consecutive exons for genome editing.

Class 2 CRISPR Systems

CRISPR-Cas9

Type II CRISPR / RNA guided DNA Endonuclease / blunt end double strand DNA cut

  • ~64-nt guide RNA to encode target specificity.
  • Chimeric crRNA-tracrRNA hybrids (sgRNA) direct Cas9 cleavage within mammalian genomes to stimulate NHEJ or HDR-mediated genome editing.
  • Blunt ends; protospacer-adjacent motif (PAM) immediately downstream (3') of the target site.
  • saCas9 : 1053 aa Staphylococcus Aureus Cas9. PAM = NNGRRT. blunt end dsDNA cut
  • spCas9 : 1368 aa Streptococcus Pyogenes Cas9. PAM = N20-NGG. Versatile balance between PAM complexity (specificity) and construct size.
  • stCas9 : 1121 aa Streptococcus thermophilus (St1Cas9) PAM = NNAGAAW. 1388 aa St3Cas9 PAM = NGGNG

NHEJ

  • (1) DSB recognition
  • (2) processing of nonligatable DNA termini
  • (3) joining of two suitable DSBs
  • NHEJ constrains broken DNA ends in the absence of end resection for repair initiation (ie Insertion/Deletion (Indel)).
  • NHEJ : Ku heterodimeric repair scaffolds associate with DSB ends. Stochastic insertions and deletions (Indel) introduction occurs when complimentary strands undergo micro-alignment dependent end resection / repair misalignment leading to frame shift. Useful for gene disrutpion. Observable within 12 hours at high efficiencies (<70%).
  • Indel : Insertion deletion of bases in the genome of a cell.

HDR

  • Overview
  • Rad51 family association with DSBs recruit accessory factors directing genomic recombination via homologous arms on an exogenous repair template.
  • HDR enhancers, L755507 and Brefeldin A, achieve maximal effects at 5 μM and 0.1 μM respective; increases efficiency of HDR dependent GFP insertion ~3 fold vs. DMSO-treated.
Components

Cas9/KO

  • U6 promoter:human
  • T2A peptide:Thosea asigna virus
  • GFP:Aequorea victoria
  • NLS:SV40 virus
  • Cas9:Streptococcus pyogenes bacteria
  • CBh promoter:chicken
  • gRNA scaffold:bacteria
  • 20 nt non-coding RNA sequence

HDR

  • EF1a Promoter:human
  • RFP:sea anemone Entacmaea
  • Puromycin:bacteria Streptomyces alboniger
  • T2A peptide:Thosea asigna virus

Cre Recombinase

  • Promoter:CMV virus
  • Cre:bacteriophage
  • NLS:SV40 virus

CRISPR-Cas12

Type V CRISPR / RNA guided DNA Endonuclease / generates staggered cuts with 5'overhang

  • Cas12a: higher specificity/ lower seed mismatch tolerance (staggered dsDNA cut) versus Cas9 (blunt end dsDNA cut).
  • Acidaminococcus sp. BV3L6 Cas12a (AsCas12a, AsCpf1). 5′-TTTN-3′ PAM / staggered cut @ [~19bp downstream PAM (sense)/~23bp downstream PAM (antisense)].
  • Lachnospiraceae Cas12a (LbCas12a, LbCpf1).
  • Francisella novicida Cas12a (FnoCas12a).
  • Edits AT-rich genomes/regions/ SNP-specific editing.
  • Only requires crRNA (tracrRNA-independent)/processes crRNA without tracrRNA.
  • Dna Endonuclease-TargEted Crispr TRansreporter (DETECTR) achieves attomole DNA detection merging isothermal amplification with Cas12a.

DETECTR Microbiology Diagnostic

  • DETECTR
  • 1) RNA extracted from a sample
  • 2) reverse transcription (2&3 are in 1 reaction)
  • 3) isothermal amplification using loop-mediated amplification (RT–LAMP)
  • 4) pathogen sequence targeting gRNA dependent Cas12 detection
  • 5) Activated Cas12 dependent cleavage of a reporter molecule confirms positive detection

CRISPR-Cas13

Type VI CRISPR / RNA guided RNA Endonuclease / permissive 'collateral' RNA cleavage

  • Programmable RNase activity= spacer complementarity-independent RNA/transcript degradation.
  • ~64-nt guide RNA scaffold for RNA endonuclease activation/ target specificity.
  • Target specificity via 28-30-nt spacer complementarity to target RNA.
  • Collateral cleavage
  • Collaborative post-recognition (non-specific) degradation of surrounding transcripts is limited to bacteria / not present in plant or mammal
  • crRNA spacer ~24 nt stem-loop structure with a mononucleotide protospacer
  • Specific High-sensitivity Enzymatic Reporter unLOCKing SHERLOCK Microbiology Diagnostic
  • SHERLOCK

Cas13a (C2c2)

Cas13b (C2c6)

Cas13d

  • Metabolizes endogenous transcript splicing
  • Possibile in vivo delivery due small size (~ 930 aa) /smallest size for class 2 CRISPR.

dCas13

RNA-protein scaffold mapping

Nomenclature

  • CBh  : chicken β-actin (CBA) hybrid promoter
  • CMV  : human cytomegalovirus (CMV) promoter regulatory drives constitutive protein expression; prone to methylation/silencing (ie iPSC)
  • DSB  : DNA double strand breaks undergo repair via error prone non-homologous end joining (NHEJ) or precision homology directed repair (HDR).
  • EF1A  : EF-1α promoter eukaryotic translation elongation factor 1 α (EF-1α, gene symbol EEF1A1) promoter increases transfection efficiency, the transgene expression, the proportion of expression-positive clones and in vitro copy number. Core EF1a promoter ~200-300bp in size. The ~1172bp intron-containing version (occasionally spliced out); the extra sequence yields higher level of expression than the core EF1a promoter alone.
  • HNH  : Cas9 Nuclease lobe (1 of 2); single nuclease domain.
  • HDR  : Rad51 family association with DSBs recruit accessory factors directing genomic recombination via homologous arms on an exogenous repair template.
  • Indel  : Insertion deletion of bases in the genome of a cell.
  • NHEJ  : Ku heterodimeric repair scaffolds associate with DSB ends. Stochastic insertions and deletions (Indel) introduction occurs when complimentary strands undergo micro-alignment dependent end resection / repair misalignment leading to frame shift. Useful for gene disrutpion. Observable within 12 hours at high efficiencies (<70%).
  • NUC  : Nuclease (NUC) lobe consisting of HNH domain, assembled RuvC subdomains, and a PAM-interacting (PI) C-terminal region.
  • PAM  : Target DNA sequence (protospacer) must be gRNA complimentary and contain a "protospacer adjacent motif" DNA sequence. PAM recognition -> rate-limiting R-loop propagation -> DNA dsDNA cleavage.
  • REC  : α-helical recognition (REC) lobe
  • RGN  : RNA guided Nuclease
  • RuvC  : Cas9 Nuclease lobe (2 of 2) RuvC contains three subdomains; RuvC I near the N-terminal region of Cas9 and RuvC II/III flanking the HNH domain near the middle of the protein.
  • sgRNA  : Fusion of ~20nt CRISPR RNA (crRNA) + ~60nt trans-activating RNA (tracRNA) simplifies RNA:Cas9 complex ratio from 2:1 -> 1:1, and improves editing rates relative to a dual RNA strategy. Targeted deletion utilizing 2+ sgRNA result in repair naive junctions by either sgRNA alone =higher % of Indel events. 1 sgRNA blunt end DSBs repair correct at a higher fidelity than 2+ sgRNA DSBs repair.
  • Seed Region: A subset of nucleotides within the crRNA (sgRNA) that pairs with PAM-proximal nucleotides; sensitive to mismatches, necessary for target affinity and specificity. Rate of genomic target binding (not affinity) decreases with each mismatch; CRISPRcas12 crRNA contains a larger seed region (lower mismatch tolerance) versus CRISPRcas9 (∼10 bp of the RNA-DNA helix (R-loop) proximal to the PAM).
  • U6: U6 is a type III RNA polymerase III promoter commonly used for driving ncRNA expression.

GCTAGCGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACG TAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAA

PCR

puromycin N-acetyltransferase

ATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACC GTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCG GTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAG ATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTG CTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCC GACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGA

RFP (Red Fluorescent Protein)

RFP (DsRed)

RFP excites @488 nm laser/emits 585+/-8nm (similar to PE;565nm/575nm). Compatible multichannel fluorochromes with RFP = FITC, APC, PerCP-Cy5.5, PE-Cy7

ATGAGCGAGCTGATCAAGGAGAACATGCACATGAAGCTGTACATGGAGGGCACCGTGAACAACCACCACTTCAAGTGCACATCCGAGGGCGAAGGCAAGCCCTACGAGG GCACCCAGACCATGAAGATCAAGGTGGTCGAGGGCGGCCCTCTCCCCTTCGCCTTCGACATCCTGGCTACCAGCTTCATGTACGGCAGCAAAGCCTTCATCAACCACAC CCAGGGCATCCCCGACTTCTTTAAGCAGTCCTTCCCTGAGGGCTTCACATGGGAGAGAATCACCACATACGAAGACGGGGGCGTGCTGACCGCTACCCAGGACACCAGC TTCCAGAACGGCTGCATCATCTACAACGTCAAGATCAACGGGGTGAACTTCCCATCCAACGGCCCTGTGATGCAGAAGAAAACACGCGGCTGGGAGGCCAACACCGAGA TGCTGTACCCCGCTGACGGCGGCCTGAGAGGCCACAGCCAGATGGCCCTGAAGCTCGTGGGCGGGGGCTACCTGCACTGCTCCTTCAAGACCACATACAGATCCAAGAA ACCCGCTAAGAACCTCAAGATGCCCGGCTTCCACTTCGTGGACCACAGACTGGAAAGAATCAAGGAGGCCGACAAAGAGACCTACGTCGAGCAGCACGAGATGGCTGTG GCCAAGTACTGCGACCTCCCTAGCAAACTGGGGCACAGATGA

GFP (Green Fluorescent Protein)

ATGGAGAGCGACGAGAGCGGCCTGCCCGCCATGGAGATCGAGTGCCGCATCACCGGCACCCTGAACGGCGTGGAGTTCGAGCTGGTGGGCGGCGGAGAGGGCACCCC CAAGCAGGGCCGCATGACCAACAAGATGAAGAGCACCAAAGGCGCCCTGACCTTCAGCCCCTACCTGCTGAGCCACGTGATGGGCTACGGCTTCTACCACTTCGGCACCT ACCCCAGCGGCTACGAGAACCCCTTCCTGCACGCCATCAACAACGGCGGCTACACCAACACCCGCATCGAGAAGTACGAGGACGGCGGCGTGCTGCACGTGAGCTTCA GCTACCGCTGCGAGGCCGGCCGCGTGATCGGCGACTTCAAGGTGGTGGGCACCGGCTTCCCCGAGGACAGCGTGATCTTCACCGACAAGATCATCCGCAGCAACGCCACC GTGGAGCACCTGCACCCCATGGGCGATAACGTGCTGGTGGGCAGCTTCGCCCGCACCTTCAGCCTGCGCGACGGCGGCTACCACAGCTTCGTGGTGGACAACCACATGCAC TTCAAGAGCGCCATCCACCCCAGCATCCTGCAGAACGGGGGCCCCATGTTCGCCTTCCGCCGCGTGGAGGAGCTGCACAGCAACACCGAGCTGGGCATCGTGGAGTACCA GCACGCCTTCAAGACCCCCATCGCCTTCGCCAGATCCCGCGCTCAGTCGTCCAATTCTGCCGTGGACGGCACCGCCGGACCCGGCTCCACCGGATCTCGC

Synergistic Activation Mediator

To initiate programmable DNA targeting, dCas9 coordinates RNA-duplex (crRNA+tracrRNA) scaffold. crRNA nucleotides 1-20 guide dCas9 adjacent to genomic protospacer adjacent motif(s) (PAM). Fusion of crRNA+tracrRNA generates a chimeric single guide (sgRNA).

Synergistic activation mediator (SAM) system

  • Incorporates two MS2 hairpins into exposed loops within the sgRNA
  • Fuses MCP to a novel chimeric activator p65-HSF1 (p65 subunit of NF-kB/HSF1 heat shock factor 1 transcription response to temperature stress)
  • Chimeric MCP-p65-HSF1 activators bind each MS2 hairpin as a set of homodimers
  • 4 copies of MCP-p65-HSF1 scaffolding onto the SAM sgRNA, bound via dSpCas9-VP64
  • Optimal upstream (-200)-(+1) >> (-400)-(-50)

Features

  • Recruitment of activators in trans
  • Insertion of protein binding RNA Aptamers (MS2) into sgRNA coordinates MCP
  • Heterogenous activator(s) (p65-HSF1)
  • Optimal upstream (-400)<->(-50) / (-200)<->(+1)

CRISPR Synergistic Activation Mediator Nomenclature

  • 2A  : self-cleaving peptide motif 2A peptide
  • dCas9: mutant Streptococcus (pyogenes) Cas9 nuclease with inactive catalytic domains utilized as a generic RNA-guided trans-modulator. RNA-guided DNA binding protein (dCas9). dCas9 may protect internal MS2 stemloops from exonuclease degradation.
  • HSF1 : Heat Shock Factor 1 transcribes gene in response to heat stress.
  • MCP  : MS2 Coat Protein (MCP) dimer binds each MS2 aptamer hairpin (1:1). (native MS2 system) Phage capsid assembly is nucleated by coat protein dimer binding to the operator hairpin.
  • MS2  : Escherichia virus (Enterobacteria phage) MS2 RNA "operator/aptamer hairpin". (tandem repeat fusion to 3' sgRNA). noncoding scaffold. minimal hairpin aptamer selectively binds dimerized MS2 bacteriophage coat protein (MCP). MS2 stem-loop placement within the sgRNA influences transcription activation efficiency.
  • p65  : NF-κB subunit. NF-κB trans-activating subunit p65 shares common co-factors with VP64, recruits a distinct subset of transcription factors and chromatin remodeling complexes.
  • RTA  : Human herpes virus 8 (HHV-8) transactivator.
  • sgRNA: single guide RNA = chimeric Crispr RNA (crRNA) + transactivating crRNA (tracrRNA).
  • VP64 : VP16 x4 / Herpes (alpha-TIF (trans-inducing factor) HHV-2 transactivator protein recruits transcription factors OCT-1 and Host cell factor 1 (HCF). (component of chimeric VP64-dCAS9).

CRISPR Nickase

Wild-type Cas9 Nuclease cleaves DNA via RuvC and HNH nuclease domains, that generate blunt end double strand breaks. Double nicking is achievable when Cas9 nickase (RuvC / HNH) complexing with appropriately spaced target sites mimic a double strand break via cooperative nicks.

  • Nickase HNH+  : HNH single nuclease domain cleaves DNA strand complementary to the RNA guide. Type 2 Streptococcus Cas9 contains 2 nuclease domains; RuvC / HNH
  • Nickase RuvC+ : RuvC 3 subdomain (RuvC1 @ N-terminal, RuvC2/3 flank HNH). Nuclease cleaves DNA strand non-complementary to the guide RNA. Type 2 Streptococcus Cas9 contains 2 nuclease domains; RuvC / HNH

Stem Cell / Sensitive Cell DNA Transfection

For DNA transfection of primary cells and sensitive cell lines, Effectene Transfection Reagent is a nonliposomal lipid reagent for DNA transfection into a broad range of cell types. Due to low cytotoxicity, Effectene Transfection Reagent is suitable on primary or other sensitive lineages.

Selection

Synergistic Activation Mediator

Parameters

  • 13ul (5,000 particle/ µL) @ 200,000 cells per 35mm diameter = MOI 0.325
  • 6 Well / 10e5 (100,000 cells) per well /

200uL @5,000 particles/µL = 10e6 particles

MOI 1 = 20µL

MOI 3 = 60µL

MOI 5 = 100µL

Selection

  • Puromycin  : 0.5 µg/ml
  • Hygromycin B  : 75-100 µg/ml

ATGAAAAAGCCTGAACTCACCGCGACGTCTGTCGAGAAGTTTCTGATCGAAAAGTTCGACAGCGTCTCCGACCTGATGCAGCTCTCGGAGGGCGAAGAATCTCGTGCTTTCAGCTTCG ATGTAGGAGGGCGTGGATATGTCCTGCGGGTAAATAGCTGCGCCGATGGTTTCTACAAAGATCGTTATGTTTATCGGCACTTTGCATCGGCCGCGCTCCCGATTCCGGAAGTGCTTGA CATTGGGGAATTCAGCGAGAGCCTGACCTATTGCATCTCCCGCCGTGCACAGGGTGTCACGTTGCAAGACCTGCCTGAAACCGAACTGCCCGCTGTTCTGCAGCCGGTCGCGGAGGCC ATGGATGCGATCGCTGCGGCCGATCTTAGCCAGACGAGCGGGTTCGGCCCATTCGGACCGCAAGGAATCGGTCAATACACTACATGGCGTGATTTCATATGCGCGATTGCTGATCCCC ATGTGTATCACTGGCAAACTGTGATGGACGACACCGTCAGTGCGTCCGTCGCGCAGGCTCTCGATGAGCTGATGCTTTGGGCCGAGGACTGCCCCGAAGTCCGGCACCTCGTGCACGC GGATTTCGGCTCCAACAATGTCCTGACGGACAATGGCCGCATAACAGCGGTCATTGACTGGAGCGAGGCGATGTTCGGGGATTCCCAATACGAGGTCGCCAACATCTTCTTCTGGAGG CCGTGGTTGGCTTGTATGGAGCAGCAGACGCGCTACTTCGAGCGGAGGCATCCGGAGCTTGCAGGATCGCCGCGGCTCCGGGCGTATATGCTCCGCATTGGTCTTGACCAACTCTATC AGAGCTTGGTTGACGGCAATTTCGATGATGCAGCTTGGGCGCAGGGTCGATGCGACGCAATCGTCCGATCCGGAGCCGGGACTGTCGGGCGTACACAAATCGCCCGCAGAAGCGCGGC CGTCTGGACCGATGGCTGTGTAGAAGTACTCGCCGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAGGGCAAAGGAATAG

  • Blasticidin S HCL : 0.5 µg/ml

ATGGCCAAGCCTTTGTCTCAAGAAGAATCCACCCTCATTGAAAGAGCAACGGCTACAATCAACAGCATCCCCATCTCTGAAGACTACAGCGTCGCCAGCGCAGCTCTCTCTAGCGACG GCCGCATCTTCACTGGTGTCAATGTATATCATTTTACTGGGGGACCTTGTGCAGAACTCGTGGTGCTGGGCACTGCTGCTGCTGCGGCAGCTGGCAACCTGACTTGTATCGTCGCGAT CGGAAATGAGAACAGGGGCATCTTGAGCCCCTGCGGACGGTGCCGACAGGTGCTTCTCGATCTGCATCCTGGGATCAAAGCCATAGTGAAGGACAGTGATGGACAGCCGACGGCAGTT GGGATTCGTGAATTGCTGCCCTCTGGTTATGTGTGGGAGGGCTAA

Components

【Lenti dCas9-VP64-Blast】

  • dCas9 (D10A/H840A) (Streptococcus pyogenes)
  • NLS: nuclear localization signal (SV40)
  • VP64 (Herpes Simplex Virus derived)
  • 2A peptide—>(Thosea asigna virus)
  • Blastcidin resistance gene—>Bacillus cereus
  • EF1a promoter—> human

【Lenti MS2-P65-HSF1-Hygro】

  • MS2:Bacteriophage MS2 coat protein
  • P65:Human
  • HSF1:Human
  • NLS: nuclear localization signal: (SV40)
  • 2A peptide:Thosea asigna virus
  • Hygromycin resistance gene:E,coli
  • EF1a promoter:human

【Lenti sgRNA (MS2)-Puro】

  • sgRNA
  • gRNA Scaffold :(MS2 aptamer-modified tetraloop and stem loop 2 (MS2 loops))
  • U6 promoter:human
  • Puromycin resistance gene:Streptomyces alboniger
  • EF1a promoter:human

HIV derived

  • 5'LTR: 5'Long Terminal Repeat (Lentivirus)
  • cPPT: Central Polypurine Tract (Lentivirus)
  • RRE: Rev Response Element (Lentivirus)
  • Psi Sequence (Lentivirus)
  • 3'LTR: 3'Long Terminal Repeat (Lentivirus)

Intersectional genetic targeting

  • Dre/Cre recombinase 33567267
  • Flp (recombinase flippase (Flp))
  • 38kDa Cre (integrase) recombinase: topoisomerase I-like site specific recombination between two DNA recognition sites (LoxP sites; 34bp: 13 bp palindromic sequences flanking 8bp spacer)
  • type specific expression of target genes (EF1-LSL-tTA knockin) Eef1a1-2xloxP (LSL)-tetracycline-controlled transactivator (tTA). homologous recombination approach targeted insertion of (tTA) into endogenous eukaryotic translation elongation factor 1 alpha 1 (Eef1a1) locus; tTA is preceded by a transcriptional Stop sequence (i.e., three polyA signals), which is surrounded by two loxP sites (LSL).

Reference