DIYbio/FAQ/Equipment

From OpenWetWare
Jump to navigationJump to search

Intro    In The News    Educational    Equipment    Projects    Kits    Methods    DIYbio.org    DIYbio googlegroup    FriendFeed - DIYbio    http://c.statcounter.com/5195189/0/1a5d59b0/1/0.png

DIYbio FAQ v1.5: "The biohacker's FAQ"

This FAQ for DIYbio is actively maintained by it's editors, and by you! Edit your contributions directly or email updates to the DIYbio email list, [email protected].
Major contributors (in alphabetical order):
The contents of this FAQ are copyright under the OpenWetWare Copyright policy (Creative Commons Attribution-ShareAlike 3.0 Unported). When quoting any content of this FAQ elsewhere, include a full hypertext link back to the main FAQ page.

This topic Equipment and Consumables is part of the DIYBio FAQ

Please update this FAQ mercilessly with Q&A !


What equipment do I need to perform DIYBio-related projects?

  • Basic biology equipment (see here for PCR equipment, however much of the equipment isn't actually required)
    • or generic tools used in other projects, just use it for biology (see MacGyverisms below)
  • Basic computer equipment
  • Perhaps some open source software development tools


 For Yeast and bacterial work, you'll need some microbiology equipment, 
 almost all of which is available from www.brouwland.com in the lab 
 section. Offhand I think you'll just need some gloves, autoclave tape, 
 and a pressure cooker in addition to the brouwland stuff. 
 Simply:
 1. Go to www.brouwland.com
 2. Click "EN" for English site.
 3. On the left, click "Measuring/Lab
 4. First port of call from here is "Yeast Propogation"
 4a: What to buy:
 You'll need several of the glass petri dishes, one of the "Inoculation loop
 handle + 2 loops", either a bunsen or alcohol burner (I suggest alcohol
 unless you know someone familiar with gas burners; huge safety issues
 there). You'll also need some agar; you use about 20g/L for agar, so 25g is
 enough for 1L of medium, which actually goes a long way when you're starting
 out. If you feel you're definitely going to keep biotech on as a hobby, go
 for the 100g to save money and later time. You'll get this cheaper on ebay
 but it might take some hunting.
 5. Go back to "Measuring/Lab" and go to "Glassware for Laboratory"
 5a: Go into the Erlenmeyer section and pick up at least one of each 100ml
 and 250ml erlenmeyer flasks, they're very useful.
 (You don't really need beakers or measuring jugs; you can easily use
 cookware equivalents of these that cost less.)
 5b: Go into the Test tubes and accessories section and get some test tubes.
 You won't be using caps when growing Bacilli, but if you foresee yourself
 growing E.coli or yeast you might as well splash out on the capped ones. I
 suggest getting at least some uncapped ones; you'll probably be using
 tinfoil caps if you can't find tin caps on ebay. The tubes are for growing
 small liquid or agar cultures, and tend to retain sterility better than a
 petri dish when treated right.
 Get a stand for your test tubes, you won't regret it.
 You will need one item not available from brouwland (I don't know why), and
 that is a test tube brush. Test tubes are otherwise very difficult to keep
 clean. You can get a test tube brush from this ebay seller:
 http://stores.ebay.ie/Laboratory-Stuff-and-Fishy-Things
 In particular, here's one:
 http://cgi.ebay.ie/8mm-12mm-Test-Tube-Cleaning-Brushes-Glass-Lab-Pk10...
 You may need stuff to handle liquids at a smaller level than cookware can
 provide, but that's for later. Basic microbiology stuff can be handled with
 the above plus some stuff you buy locally.
 If you're not buying a bunsen (and I would suggest that you don't,
 considering you have probably no experience with propane burners or bunsen
 burners and they can kill you dead), you'll need to buy a HEPA-or-better air
 purifier and jury-rig it into a boxed arrangement to provide you with a
 sterile working area. You can get HEPA air purifiers from eBay, Argos or
 some department stores. You want something that'll filter the air until it's
 essentially sterile, and HEPA is usually good enough for that. It's
 expensive, but it won't kill you if you screw up. You can use an alcohol
 burner to sterilise your metal loops while you work under the HEPA
 inoculating agar sterilised in a pressure cooker.
 You'll need a pressure cooker, and someone who knows how to use one. Modern
 pressure cookers aren't as bad as they used to be when they got a bad
 reputation, but they are still about as dangerous as a chip-pan, which is to
 say they are still dangerous. Find someone who knows how to cook with one,
 or can help you learn properly. There are plenty of youtube videos, but half
 of them are either wrong or not careful enough; they assume that you're
 cooking a casserole for 3 minutes, whereas you're boiling water and glass
 for 25 minutes. Big difference.
 I suggest also buying this from the Ebay seller above:
 http://cgi.ebay.ie/25mm-Autoclave-Indicator-Tape-NEW-and-UK-/11043099...
 This is autoclave indicator tape. If you've used the pressure cooker
 correctly to sterilise the stuff inside, the tape will show dark black
 stripes. If you did it wrong, it won't change colour sufficiently, and your
 agar or broth may become contaminated. This is a nuisance. If you're
 disposing of hazardous or legally controlled waste some day, insufficient
 sterilisation of waste can get you put in prison; for example, GMOs and
 genetically engineered animals/plants etc etc *must* be destroyed completely
 under EU law before disposal, and innocuous microbes are no exception. So
 get the tape, learn how to sterilise things effectively from the beginning
 and don't forget.
 If and when you get all this stuff together and ordered, get B.subtilis. 
 You don't actually need B.subtilis though, because you can
 get baker's or brewer's yeast in most shops near the
 breadmaking supplies; wake it up with some water and you can
 teach yourself microbiology with yeast right away.
 B.subtilis is only different in that it's a bacteria rather
 than a yeast, and that it cannot be easily grown without air
 (you can seal yeast, you can't seal B.subtilis or it'll
 choke). 
 The loop handle is a separate item. Petri dishes are on the
 same list, but just come as a glass petri dish sold singly.
 The loop handle is for holding metal loops that are used for
 inoculating and spreading cells, which can be sterilised
 quickly between uses in a flame. The loop handles sold on
 www.Brouwland.com come with two loops, but treated well you
 probably won't need to replace the first loop anytime soon. 
 For green points, just recycle jars of pasta sauces or other
 heat-sterilized foods: those *are* canning jars, which are
 normally discarded.
 Look for ones with the freshness dimple on the lid, because
 it'll work again.
 Just make sure you don't real the jars before sterilizing-
 leave the lids loose, then seal them while still
 uncomfortably-but-dangerously hot. The dimples will pop in
 as they cool.
 Then, trust in the dimples. If they pop without you opening
 the can, it implies unwanted fermentation is taking place
 and your sterilisation failed.  Or perhaps that lid is
 faulty and lets air leak in, though so far jars have worked
 well for me.
 PDA is great as an all purpose recipe. I, too, recommend
 this venerable medium (see below). 
 Yes, you'll also need pipettors. I suggest for larger volumes
 (5mls - 25mls) to buy a rubber-bulb pippettor and glass
 pippettes from a good brewing supplier such as
 http://www.brouwland.com/ Don't forget to get a pippette
 cleaning brush! You'll need it. To sterilise glass pippettes
 of this size/type, it's probably easiest to wrap them
 individually in tin-foil and bake them in dry heat for a long
 time. Google dry heat sterilisation to find out how long and
 at what temperature.
 For smaller pipette volumes, consider using glass-droppers
 sterilised with bleach for normal routine stuff, presterilised
 pasteur plastic pipettes for important stuff, and for under
 1ml you'll need to get a micro-pipette set and tips to match.
 Those guys can unfortunately be expensive.
 For working in a sterile environment, you'll want a bunsen
 burner probably, and/or a new HEPA-or-better air purifier. A
 Bunsen creates a zone of sterile circulating air surrounding
 the flame when it is blue, as long as you're in a room with
 still, relatively clean air. Don't lock yourself anywhere
 airtight though or it might suffocate you... :-/ HEPA air
 purifiers filter air of spores and microbes, giving you an
 airstream of sterile air (in theory at least). Arranging
 things so this airflow hits your working area from above can
 mean that contamination can't reach your work. It's also less
 flammable than a bunsen, but you don't have a flame handy when
 you want to sterilise metal surfaces, such as the little metal
 inoculating loops normally used to transfer bacteria about the
 place.
 For growth media for bacteria, you can use
 potato-dextrose-broth and agar for growing a lot of the cool
 bugs, including Bacillus subtilis. It's really easy to make.
 So easy I put it on the back of my business cards! ;) Here's a
 recipe for Potato-Dextrose Broth/Agar:
    1. Boil 200g sliced potato in 1L bottled or deionised water (to avoid
    chloramine. If the water authorities use chlorine rather than chloramine,or
    if you have a well, you can use tapwater! Ring and ask, it'll save you loads
    of money). Boil for 30m.
    2. Filter through a J-cloth or Cheesecloth, then leave to settle in a
    tall vessel so it can clarify. When clear, carefully pour off the clear
    liquid into another container, and add 20g glucose/dextrose (same thing).
    This is Potato-Dextrose Broth, when you bring it back to 1L with water. If
    you want Agar, add 20g of Agar before bringing to 1L.
    3. Stir for broth to dissolve, and simmer for agar to dissolve the agar.
    Before it solidifies, put it into glass test tubes or glass petri dishes (
    http://www.brouwland.com/) as needed, and then pressure cook it for at
    least 20m at full pressure and steam. This is needed to sterilise it
    effectively, as spores from the potatoes themselves can often grow in the
    agar if not done correctly. You're best off searching for someone who knows
    how to use a pressure cooker, or doing a lot of reading. They are honestly
    quite safe these days, as safe as any cooking implement (chip pans and
    untended frying pans are much much worse!), but if you don't do it right,
    you might damage the pot, burn yourself with steam, or at least not
    sterilise things correctly.
    4. When they are fully sterilised, leave them to cool within the pressure
    cooker, and try to remove them only when you plan to use them so they can't
    get contaminated. Using masking tape around the rim of petri dishes once
    inoculated can help prevent contaminating air circulating in and out, but
    use low-stickiness tape or you'll send dishes flying trying to get it off.
    If they are masking-taped securely, you can dry them a bit by putting them
    upside-down somewhere warm; this will help prevent bacteria from washing all
    over a plate when you inoculate them due to surface water.
 So you've got incubation, sterility and a cheap and easy
 medium to grow at least yeast/bacillus in. Advanced
 manipulating will also require a centrifuge: I recommend for
 low-speed, high safety that you consider the NCBE
 microcentrifuge:
 http://www.ncbe.reading.ac.uk/ncbe/materials/dna/microcentrifuge.html
 Please note though that, so far as I can tell, they
 overestimate the G-forces it can reach, because they measure
 the centrifuge's rotary radius from the centre to the edge of
 the tubes. Convention suggests instead that you measure to
 half-way down the tube, and re-calculating the results gives
 you a lower range. Still, it's enough to centrifuge bacteria
 out of suspension easily.  If you need more power without any
 endorsement of safety, you can get a Dremelfuge here:
 http://www.shapeways.com/model/77306/Dremelfuge.html You'll
 need a Dremel to go with it, I use the Dremel 300 plug-in
 tool.  You'll also need safety googles at the very least! Bolt
 it to something so the rotor is horizontal if you plan to use
 it, and be careful to load samples equally on all axes, and
 securely. This one reaches some pretty obscene speeds and
 forces, and isn't necessary for microbiology at all, although
 for spinning down DNA and protein it'll work quite nicely. :) 


-- Cathal Garvey on the DIYbio google group
 As I mentioned earlier on a different thread, get a pressure cooker
 and some canning jars (in the U.S. we call these Ball or Mason jars),
 and learn how to make PDA (potato dextrose agar).
 You should be able to get all of that locally, the dextrose (a.k.a.
 glucose) can found in nutritional supplement stores, and agar can be
 found in asian supermarkets.
 You don't need the innoculation loop and handle, just get some craft
 sticks (popsicle sticks), throw them in a jar or well wrapped
 tin-foil, and pressure cook them above the water line in the cooker...
 or alternatively bake in the oven for a few hours.
 Then you can start culturing yeast from bakers yeast packets and learn
 good sterile technique, testing yourself by looking to see that you
 don't get contamination in your yeast cultures. 
-- Nathan McCorkle on the DIYbio google group


 Cheaper than micropipettes, though not quite as
 environmentally friendly, are insulin syringes. A "unit" of
 insulin is 10 uL. The 1/3cc syringes are marked in half-unit
 increments and the larger ones are marked in units. Don't
 forget the sharps bin, though! In the US, Hocks Pharmacy
 (http://www.hocks.com) will ship you insulin syringes without
 a prescription, and a small sharps bin is something like three
 bucks. 
-- Meredith L. Patterson on the DIYbio google group

What equipment do I need to preserve my microbes?

  • Freeze the microbes at low temperature storage, as below.
    • The general rule is the cells lose 1/3 to 1/2 competency (for transformation) each freeze-thaw cycle.
On Oct 3, 9:42 am, Tom Randall <[email protected]> wrote:
> On Oct 2, 4:59 pm, Ben Gadoua <[email protected]> wrote:
> 
> >   E. coli is best snap frozen in LN2 but it keeps at -20C or -80C for years
> > and years, best to keep it at -20C instead of 4C because at 4C e. coli is
> > still slowly growning.
> 
> > Ben
> 
> -20C is fine. In any ordinary (manual-defrost) freezer. I recently revived some E. coli
> strains from a previous lab that I had simply stored in my kitchen
> refrigerator (freezer compartment of course, next to frozen OJ et al.)
> for 6+ yrs frozen in 50% glycerol/LB. Those with plasmids still grew
> up with amp selection and plasmid preps produced the right plasmid.
> Have since restocked, again in 50% glycerol/LB in a dedicated -20C
> freezer this time, again off the shelf, used, approx 6 cu non frost
> free freezer for stocks and enzymes. One reason for using E. coli K12
> even if not your final organism of interest, is that it is easy to
> maintain without much specialized storage. Maintaining competent cells
> is likely a more difficult proposition and unless you are willing to
> go the -70C route you will likely have to live with a shorter shelf
> life and some loss of transformation efficiency over time.
-- Ben Gadoua and Tom Randall on the DIYbio google group.
On Oct 2, 3:58 am, Cathal Garvey <[email protected]> wrote:
> A note on unfreezing stock cells; try not to!
> 
> If you have cells frozen in glycerol/media, try to scrape a tiny bit off the
> surface, and use that to start a new culture. Put the rest right back in the
> freezer. The reason being, cells don't survive repeated freeze/thaw cycles
> very well at all. Best to keep them frozen all the time, and only thaw the
> tiny bits you scrape off the top.
-- Cathal Garvey on the DIYbio google group.


On Oct 1, 7:38 pm, Ben Gadoua <[email protected]> wrote:
>   Most labs that I've seen keep some frozen stock of the basic e. coli with
> no transformation, frozen either as a stab culture or with DMSA/glycol mixed
> into the media+e. coli. After that labs unfreeze part of the e. coli
> culture, or take some, on the the tip of a pipetter and dilute it into your
> plasmid, do your heatshock or electroporation, and then add rich culture
> media and let it mature in a shaker incubator for around an hour, we aren't
> looking for confluency here, we just want the bacteria to be more
> concentrated, an hour or so is about 3 doublings, so however much bacteria
> we started with has now been multiplied by 8. (In rich media at optimal
> temperature with good aeration, e. coli doubles every 20 minutes) Then you
> do as Bryan alluded to, a streak plate, you could also do two plates, one
> with 90% of the culture spread out over the surface and another with 10% of
> the culture spread out over the surface. Both methods are valid, but if you
> have a very high concentration of culture, IE. you forgot about your bullet
> prep and left it for 4 hours, a streak plate may be better because it lets
> you dilute your culture 8-32 fold depending on how many times you streak.
> The plates that you'll use for your streaking will have an antibiotic in
> them that kills all of the bacteria that you hadn't transformed, because the
> plasmid that you put into the bacteria will have had an antibiotic
> resistence. Another reason for this antibiotic resistance is that any of the
> other stray bacteria that may have gotten into your culture the times that
> is was open will also be killed.
> 
>  So there you have it, e. coli culture in a nutshell.
> 
> Ben
-- Ben Gadoua on the DIYbio google group.


On Oct 3, 3:54 pm, Cory Tobin <[email protected]> wrote:
> Regarding freezers: any ordinary freezer will probably be fine for
> keeping bacteria frozen for a few months.  But keep in mind most
> freezers in people's kitchens are auto-defrosting, meaning they
> occasionally raise the temperature to melt the ice.  If you are going
> to purchase a freezer specifically for biology, I would recommend
> getting a manual-defrost freezer.  It will probably be cheaper than an
> auto-defroster anyways.
> 
> -Cory
-- Cory Tobin on the DIYbio google group.

What equipment is in a basic biology lab

  • A note to readers.. please add more answer to this question

Where can I find auctions for biotech?

See DIYBio FAQ Main Page, Appendix 2, List of Equipment Suppliers

What Equipment can I build myself ?

See DIYBio FAQ: Projects for a growing list of equipment to build right now.

How can I make a spectrophotometer?

See DIYBio FAQ: Projects

How can I make an atomic force microscope (AFM)?

How can I make a sterile environment?

Using Ultraviolet (UV) for sterilization

Here is a table of how much UV exposure it takes to kill various organisms and bacteria. Note units are in microwatt-seconds per cm2. Specs for UV lamps usually give emission as microwatts per cm2 measured at a distance of 1 m from the lamp.

Do not leave UV lamps on for long periods of time because the bulbs "wear out". Specifically, the amount of UV produced will decrease over time (see manufacturer spec sheets). With extended use, it may seem that the bulb is creating a sterile environment when actually it is not producing enough UV.

Warning: UV spectrum of sterilization bulbs are bad for you. Do not expose yourself to the UV. If you build a UV "hood", add a switch which always turns the light off when the door is opened.

What Equipment have other DIYBio members made? Can I buy one from them? Where are the plans?

See DIYBio FAQ: Projects

How can I cheaply substitute, reuse, recycle, sterilize, or "refresh" equipment?

Reusing Electroporation Cuvettes

""If you have ever worked out the price of an electroporation cuvette you will realise that, at several dollars each, they are worth recycling. Accounts on how amenable electroporation cuvettes are to recycling vary, but I find that as long as you treat them well it is possible to use single cuvette many times. [...] "" See http://bitesizebio.com/2008/04/30/re-cycling-electroporation-cuvettes/


Reusing Spin Columns

 To reuse the Qiagen columns:
 I've been working with an iGEM team operating on the cheap this year
 and found the openwetware buffer solutions to work just great. Here is
 the protocol on renewing the spin columns:
 - soak column 24-48 hr in 1M HCl - try make sure no air bubbles at
 filter surface
 - store in acid to inhibit contamination - say 0.1M HCl
 - before use, rinse and reequilibrate
   - 3-5x 0.75mL dH2O spin thru, discard
   - 1x 0.75mL PE spin thru, discard and spin again
  See BioTechniques 42:186-192 (February 2007)
-- Derek, on the DIYbio google group

Substituting Spin Columns

   Epoch Biolabs spin columns compared to Qiagen spin columns
   Epoch Biolabs Spin columns, (http://www.epochbiolabs.com/minispin.asp)
   I got a free sample of item # 1910-250 (around 10 sent).
    
   Grew 2 ml cultures of E coli containing either pUC18 or pBlueScript SK
   + overnight at 37C (LB with 50 ug/ml amp).
   Used 1 ml of each plasmid culture and prepped plasmid DNA with either
   Qiagen (Cat #27104 Qiaprep spin miniprep kit) or Epoch spin columns.
   Did both using Qiagen supplied buffers using the same protocol.
   From the final prep of 50 ul DNA I used 10 ul of plasmid DNA (~500 ng)
   for an EcoRI digest, ran on a 0.7% agarose gel and, again by eye, not
   true quantitation,
   both spin columns seem absolutely equivalent.
    
   Again, Epoch is much cheaper, Qiaprep kit is $81 with 50 columns, I
   have already purchased their basic offering of 250 columns for $95,
   should last forever if I recycle them. One does have to make your own
   buffer, Epoch does not supply, so one would have to factor in the cost
   of the chemicals you need to buy, but over the long term this will
   also be a savings.
   This was sent to my residence, which was good.
   The only odd thing about their ordering process is they want a Tax ID,
   which I do have since I set up as a non-profit in 2003. Dont know if
   you can get around this or not if you order by phone.
-- Tom (tarandall) on DIYbio google group

Chemicals and Reagents are expensive. How can I make my own? What can I substitute?

Substitutes for Agarose

  • Some opinions state Agar is too expensive and alternatives exist.
  • It is possible to use substitutes for Agarose depending on the experiment and the need for precision in the result.
"Agarose seems expensive (500g for $300) however this makes almost 25 litres of 2% solution, enough for approx. 1000 gels. 30 cents a gel ain't that bad compared to precast costs."
-- Ben Gadoua on DIYbio google group


Using Agar instead of Agarose

"We have recently attempted to find an inexpensive alternative to agarose for analytical purposes. We observed that agar is an adequate support medium for gel electrophoresis (Fig 1). [...] These included Difco Bacto-Agar (Detroit, U.S.A.), Merck Agar-Agar (Darmstadt, Germany), Oxoid agar (London, UK.), Biolab Agar (Halfway House, R.S.A.), Bitek Agar (Detroit, U.S.A.) and bulk agar obtained from New Zealand. All these agar formulations gave good separation of our DNA ... Conclusion: ... agar can be used as a gel matrix in place of agarose in many instances. We do not recommend using agar if the DNA is to be purified from a gel. We have attempted experiments involving the southern blotting technique using agar as our gel matrix. Our results were, however, unsatisfactory. We therefore recommend that agar gels can be used as a cheap altelnative to agarose to check the purity, size and amount of DNA in a sample."
From: AGAR, AN ALTERNATIVE TO AGAROSE IN ANALYTICAL GEL ELECTROPHORESIS, BIOTECHNOLOGY TECH, CD. Viljoen, B.D. Wingfield* and M.J. Wingfield Volume 7 No.10 (October 1993) pp723-726. DOI:10.1007/BF00152620
"The other option is to wash with two changes of EDTA (think it was 25mM) to remove divalent metals and sulfonated (non-gelling) agar. There is also a process based on alcohol washes - but can't find my reference to it."
-- Abizar on DIYBio google group
"Most agar has a lot of positively charged groups on it that interfere with electorphoresis if DNA. That's why we use agarose, which is either derived from a source very low in these groups or chemically modified. I worked for a DNA fingerprinting company and had to lead a troubleshooting team once to find out why our DNA bands were all smeary on gels- turned out our agarose supplier had switched where they sourced their agarose from, and it was too full of sulfhydryl groups to run the large slab gels well (although apparently it was OK for smaller gels with shorter DNA fragments). Agar is normally much worse, since they don't expect anyone to use it for gels. Acrylamide is toxic until it polymerizes. You can buy precast gels to minimize your risk, but they are expensive."
-- EJ on DIYbio google group
" As a suggestion, if you're using Agar instead of Agarose, you can prerun it for maybe half an hour to try and get rid of many of the positive contaminants. You could also wash the agar in alcohol and then in ketone to try and get some of the impurities out. You'll have to try it and see, there's no other way to tell, if you want to use agar you might want to use smaller dna fragments, they run better on less pure gels. "
-- Ben Gadoua on DIYbio google group


   agar-agar
   Went to local Asian Store and bought a quantity of Telephone brand
   agar-agar. ($1.59/25 g packet)
    
   Visually it appeared significantly more pure than bacto agar, similar
   to washed agar, a very fine powder. Worked well at 1% whereas bacto-
   agar usually needs 1.5-2% concentration in plates, likely can use at
   conc. lower than 1%.
   Tested growth of pUC18 and pBSSK+ containing E coli strains on LB amp
   and LB amp+xgal+IPTG (all at standard concentrations) and in all cases
   growth under amp selection was equal between bacto-agar and agar-agar
   and lacZ complementation resulting in blue color was as good as with
   bacto agar.
   Tested the ability of agar-agar to test auxotrophic mutations (limited
   test with two auxotrophies, commonly used his-3 (histidine) and inl
   (inositol) strains of Neurospora crassa and in each case
   auxotrophic strains would not grow on minimal media without
   appropriate supplements, which suggested to me with this limited
   testing that the agar-agar was pretty pure (no his or inl in the agar
   at least).
   So, at ~$33 for 500 g of agar-agar, about 1/10 cost of bacto agar, I
   intend to use this as long as I can buy it.
-- Tom (tarandall) on DIYbio google group

Using Other Substitutes for Agarose

Table lists starches & flours:
Table: Alternate to Agar
"Silica gel is another possible solidifying agent. Likely totally inert, and stable at high temperatures for thermophiles. "
-- Tom Knight, diybio google group
"None of those (in the 'starches & flours' table) work (well). Agar is clear and indigestable by bacteria, none of those replacements have those properties. Guar gum is the only substitue worth trying, but from what I understand it's a LOT harder to work with. For the price of food grade agar it just isn't worth trying to save money. Food grade works great for everything I've tried and you can get it pretty dang cheap online."
-- Jake, diybio google group


How do you purify agar?

"here is a good washed agar protocol, cleans up contaminants. It involves acetone, easy to find at home depot, but dont be smoking. Also the washed agar will gel at a lower concentration, 1% instead of 1.5% or 2%. As store bought stuff is less pure than Difco, it would certainly benefit more from cleaning. I have only done the second protocol." http://www.fgsc.net/neurosporaprotocols/How%20to%20wash%20agar.pdf -- Tom on the diybio google group
"Soak agar shreds or granules in "several changes" of distilled water (DI). Make a 4% gel, slice, dialyze or electrodialyze it, then use that to make a more dilute gel (no specified dilution) through reheating. Alternatively- dry and dissolve flakes later as needed. Dissolve agar "in the solvent to be employed," and hot-filter through several layers of "lintless gauze, coarse filter paper, shredded paper or diatomaceous earth, or centrifuge at high speed (eg, 5000 g) for 10 mins in a rotor pre-heated to 80 C" (small volume technique: pull into 10 mL pipette with loose cotton plug. Remove plug and deliver to plate or slide). Make agar gel from this, then chil, freeze, and thaw it to disrupt gel and "express the water and dissolved impurities." The reader is referred to Crowle 1961 (first edition of Immunodiffusion) for more detailed explanations."
From Crowe's "Immunodiffusion," 2nd ed., 1973
-- AJ, diybio google group
Preparation of agarose with cetylpyridinium chloride "or other tertiary ammonium compounds."
From Clausen in "Laboratory Techniques in Biochemistry and Molecular Biology" (volume 1, part 3, edited by Burdon and Knippenberg)
-- AJ, diybio google group
"There was another text- it mostly consisted of making slabs of gel that are then allowed to sit in distilled water, which is changed every day for a week or more."
Maybe from "Handbook of Immunoprecipitation-in-Gel Techniques," edited by Axelson (1983).
-- AJ, diybio google group


Growth Mediums

Making Bacteria Media from Potato. Many Excellent Media are Made from Plant Material. By Harold Eddleman, Ph. D. We call the food for our microbes medium (plural = media). In the early days, only kitchen foods were available for microbiological media. Potato dextrose agar is the most widely used medium for growing fungi and bacteria which attack living plants or decay dead plant matter. This page suggests media that a student can make in his home lab from plant matter such as potato, tomato, flour, cabbage, ssuu. Many species of bacteria and fungi require vitamins or factors from plants. [...]
http://www.disknet.com/indiana_biolab/b029.htm


Staining DNA when performing Electrophoresis when using Agar/Agarose Gels

For DIY environments, staining DNA can be done with "GR Safe" or "SYBR Safe", both work well. For other substitutions keep reading.

  • Note: EtBr is not used in a DIY environment due to safety issues.
"The shelf life (of GR Safe / SYBR Safe) is also longer than 6 months, provided you keep it in its container (out of the light!). I've used tubes that were several years past their prime, with no problem."
--Kay Aull, diybio google group


Methylene Blue stain

Inexpensive, "harmless" dye. Sold in pet stores, usually in the aquarium section. Can also be found on ebay.


"The disadvantage being, of course, that the resolution of Methylene Blue is pretty bad; you need a lot of DNA for it to show up. To a lesser extent, this is a problem for all alternative dyes"
-- Cathal Garvey, diybio google group


Taq

"Taq is super easy to purify, you don't need a column. If you want Taq to use in PCR, you can just grow the plasmid with the DeltaTaq insert (available from ATCC), and heat the crude lysate. If you want to clean it up a bit more, for example for an enzymatic study, try this protocol: Rapid purification of high-activity Taq DNA polymerase Pluthero Nucl. Acids Res..1993; 21: 4850-4851"
--Stacy, diybio google group


   Sibgene Taq.
   This can be purchased and home delivered from http://www.sibgene.com/
   They deliver Taq at room temp, which is odd.
    
   I tested PCR amplification of two plasmid templates so far (more
   complex DNA sources need to be examined also)
   pUC19 (NEB #N3041S)
   pGREEN (Carolina Biologicals)
   no DNA control used in all tests.
    
   using 10 ng of each plasmid in all assays with primers amplifying a
   region of the ampicillin resistance marker
   ampF GTTACCAATGCTTAATCAGTGAGGC
   ampR ATGAGTATTCAACATTTCCGTGTCGC
   primers from www.idt.com
    
    
   Basic rxn contains (in 50ul):
   10 ng DNA
   1X Supplier buffer
   0.2 mM dNTPs (Promega Cat#201912)
   1 ug ampF
   1 ug ampR
   0.25 ul Taq (all supplied at 5U/ul)
   H2O to 50 ul
    
   Using the following conditions:
   94C, 4 min
   followed by 30 cycles of:
   94C, 1 min
   55C, 2 min
   72C, 2 min
   Using a Perkin Elmer DNA Thermocycler 480 (one of the older models I
   bought several yrs ago on ebay, works good as new).
    
   10 ul of each rxn were run on an 0.7% agarose gel and stained with
   EtBr.
   Pictures are not attached as I dont know how to do that on this forum
   and I am horrible at taking good UV transilluminator pictures with
   a digital camera (any hints would be appreciated).
    
   A single PCR product of appropriate sized was obtained in all assays.
   In the originally supplied buffers, NEB and Promega Taq performed
   better than Sibgene Taq (about 2X more product) with each DNA
   template, not very quantitative, this is a simple PCR assay. Sibgene
   Taq performs equally well as NEB Taq when used in the NEB supplied
   buffer, while the NEB Taq performance falls off
   when it is used with the Sibgene supplied buffer.
    
   My conclusion is that Sibgene Taq is equivalent to the other two
   commercial sources tested and the limitation of the Sibgene Taq is the
   buffer they supply.
    
   Considering cost per unit, I would (and will) buy more Sibgene Taq but
   make sure I have plenty of NEB ThermoPol buffer around.
   Sibgene 1000U for $56
   NEB Taq 400U for $52 (not including shipping)
   Promega GoTaq 100U for $28 (not including shipping)
-- Tom (tarandall) on DIYbio google group



Stains

The following are simple stains which can be used for microbes.

"Gentian violet is easily had at drugstores as an antifungal."
--mlp, diybio google group
"Eosin is OTC at any pharmacy."
--mlp, diybio google group


Retrosynthesis: how do I synthesize this chemical compound?

Retrosynthetic analysis is a method of beginning with a target compound that you wish to synthesize, and working backwards from some otherwise ridiculously hideous and expensive compound, to more simple elements and compounds that you may be more likely to have available. In 1990, E. J. Corey won the Nobel Prize in Chemistry for his work in retrosynthetic analysis. While it is possible to manually generate a retrosynthesis tree, computational tools can assist in this laborious task. At the moment, however, there are no free software tools for retrosynthesis. The pydaylight library is a wrapper to the Daylight toolkit and might serve as a good start. Please contact Bryan Bishop if you want to collaborate on this software.

Are there any plans for a DIYbio-friendly, open source database system for biology protocols, how-tos and hardware/equipment construction?

Creating a database/informational system for constructing equipment/manufacturing is a project Bryan Bishop is working on.


Can the software tell me what equipment I need to run a particular experiment?

This is work in progress. This is known as dependency checking. The handy "checktools" program hopes to do this. ((Note: the idea here is that once the pcr.xml file makes a few friends with other protocols, software can then be written to extract a list of tools from the standardized protocol format. But this doesn't exist yet, since we only have "pcr.xml".))

Keiki gels (gels-in-a-straw) MiniFAQ

Do all of the straws run at the same rate?

"I think the key there will be making sure that all the straws are exactly the same length -- each straw behaves like a resistor, so just like any other resistive material, a greater amount of material will mean a higher resistance (and thus lower current at constant voltage)." -- Meredith

How do you stain the DNA in a straw?

"Easiest way to (stain the DNA) would be to use a stain that you add to the warm agarose before pouring, such as SYBR Safe or GR Safe (or ethidium bromide, but the cool kids don't use that anymore). I suppose you could slit the straw open with a razor blade if you wanted to use methylene blue, but that sounds like a huge pain." -- Meredith

DIY Genetic engineering

Discussion of Organisms for DIY Genetic Engineering

See the group discussions and the diybio model organisms list.

Candidates are:

  • Psychomitrella patens (a moss that is naturally competent)
  • Halobacterium NRC1 (grows in very salty media)
  • Acinetobacter baylyi ADP1


ADP1

ADP1 has been considered a good candidate for DIY Genetic Engineering because it is naturally competent.

"I developed ADP1 as a model organism for simple genetic engineering while at Scripps. The paper appears under my name in Nucleic Acids Research (5780¿5790 Nucleic Acids Research, 2004, Vol. 32, No. 19 doi:10.1093/nar/gkh881). When I did the work, ADP1 was considered A. calcoaceticus, and was given a clean bill of health (biosafetly level 1). Later, to my dismay, it was collapsed into A. baylyi, grouping it with nasty pathogens and making it thereby less accessible. My interpretation: they probably are all the same species, technically, but Acinetobacter's predisposition for collecting genes from outside sources (which is exactly what makes it so useful - read the paper), led some strains to collect a bunch of virulence factors and become superbugs, like the ones that plague hospitals. If you can get some ADP1, I would consider it as safe as Ec K-12, but be very careful with less well-characterized strains of this species, because it can and will pick up genes that offer an adaptive advantage in it's environment, so you never know what a wild-type Acinetobacter might be capable of."
-- dmetzgar, diybio google group

DNA synthesis MiniFAQ

Can I order DNA over the internet?

mrgene, e-oligos, geneoracle, etc.

What are oligonucleotides?

Wikipedia sez: "An oligonucleotide is a short nucleic acid polymer, typically with twenty or fewer bases. Although they can be formed by bond cleavage of longer segments, they are now more commonly synthesized by polymerizing individual nucleotide precursors. Automated synthesizers allow the synthesis of oligonucleotides up to 160 to 200 bases. The length of the oligonucleotide is usually denoted by "mer" (from Greek meros, "part"). For example, a fragment of 25 bases would be called a 25-mer. Because oligonucleotides readily bind to their respective complementary nucleotide, they are often used as probes for detecting DNA or RNA. Examples of procedures that use oligonucleotides include DNA microarrays, Southern blots, ASO analysis, fluorescent in situ hybridization (FISH), and the synthesis of artificial genes. Oligonucleotides composed of DNA (deoxyoligonucleotides) are often used in the polymerase chain reaction, a procedure that can greatly amplify almost any small piece of DNA. There, the oligonucleotide is referred to as a primer, allowing DNA polymerase to extend the oligonucleotide and replicate the complementary strand."

How are oligonucleotides synthesized?

Oligonucleotide synthesis is done via a cycle of four chemical reactions that are repeated until all desired bases have been added:

  • Step 1 - De-blocking (detritylation): The DMT is removed with an acid, such as TCA (get it at Sigma-Aldrich), and washed out, resulting in a free 5' hydroxyl group on the first base.
  • Step 2 - Base condensation (coupling): A phosphoramidite nucleotide (or a mix) (struct, synthesis of phosphoramidite building blocks [pdf]) is activated by tetrazole (get) which removes the iPr2N group on the phosphate group. After addition, the deprotected 5' OH of the first base and the phosphate of the second base react to join the two bases together in a phosphite linkage. These reactions are not done in water but in tetrahydrofuran (get) or in DMSO (get). Unbound base and by-products are washed out.
  • Step 3 - Capping: About 1% of the 5' OH groups do not react with the new base and need to be blocked from further reaction to prevent the synthesis of oligonucleotides with an internal base deletion. This is done by adding a protective group in the form of acetic anhydride (get) and 1-methylimidazole (get)which react with the free 5' OH groups via acetylation. Excess reagents are washed out.
  • Step 4 - Oxidation: The phosphite linkage between the first and second base needs to be stabilized by making the phosphate group pentavalent. This is achieved by adding iodine (go to local store) and water which leads to the oxidation of the phosphite into phosphate. This step can be substituted with a sulphorylation step for thiophosphate nucleotides.


(Note: this might be a good document to see how phosphoramidites can be ordered from suppliers.) Here are some oligo synth protocols in molecbio. Quantifying oligos from phosphoramadite synth. Note that you may not have to actually purchase phosphoramadites to start off with, but instead begin with a purified solution of nucleic acid??

What are the origins of oligonucleotide impurities and errors?

See here.


Microfluidics MiniFAQ

What are microfluidics?

Wikipedia sez: Microfluidics deals with the behavior, precise control and manipulation of fluids that are geometrically constrained to a small, typically sub-millimeter, scale. Typically, micro means one of the following features: small volumes(nl, pl, fl); small size; low energy consumption; effects of the micro domain (i.e., laminar flows, surface tension, diffusion, Marangoli forces, capillary forces, ...).

Even more on 'what are microfluidics'

See also:

An example of microfluidics

The following is a run of the example microfluidics T-junction simulation in elmer, an open source CFD/FEM/FEA package. What you see here is the progression of an analyte due to electro-osmotic flow. There are two electric fields, three boundary conditions and a lot of wasted hours playing around with ElmerGUI and ElmerFront.

<html>

</html>


What is a lab on a chip (LOC)?

A lab-on-a-chip (LOC) is a device that integrates one or several laboratory functions on a single chip of only millimeters to a few square centimeters in size. LOCs deal with the handling of extremely small fluid volumes down to less than pico liters. Lab-on-a-chip devices are a subset of MEMS devices and often indicated by "Micro Total Analysis Systems" (µTAS) as well. Microfluidics is a broader term that describes also mechanical flow control devices like pumps and valves or sensors like flowmeters and viscometers. However, strictly regarded "Lab-on-a-Chip" indicates generally the scaling of single or multiple lab processes down to chip-format, whereas "µTAS" is dedicated to the integration of the total sequence of lab processes to perform chemical analysis. The term "Lab-on-a-Chip" was introduced later on when it turned out that µTAS technologies were more widely applicable than only for analysis purposes.

Ultimately the idea is to have all of the typical components, procedures and processes of a laboratory available on a "chip", on a single perhaps disposable device, rather than having to build or purchase bulky equipment that sometimes tends to be hard to acquire or learn about.


Appendix - List of Equipment Suppliers

New Equipment

 please expand this list


In the United Kingdom

Microscopy

Brunel Microscopes Ltd has many years professional experience in all aspects of microscopy and specimen preparation. They stock a wide range of light microscopes, stereomicroscopes, accessories, prepared slides, stains and reagents that are suited to the professional and amateur microscopist, as well as educational establishments, industry and research.

Used Microscopes UK is a Brunel Microscopes website dedicated to preowned microscopes, accessories and ex-demonstration equipment.

Educational lab kits

Since its establishment in 1984-5, the NCBE has gained an international reputation for the development of innovative educational resources. The NCBE sells enzymes, microcentrifuges, pipettes, electrophoresis kits, transformers and other science kits.

In the United States of America

Chemical Suppliers

From the website: "Chemsavers is a distributor of laboratory chemicals. We stock many different types of chemicals and often hard to find and one of a kind chemicals. We offer below retail prices and free shipping. How can we do this? We make special purchases on sale items, bulk items and close outs. As far as most of the basic lab chemicals go, we keep them in stock as we purchase directly from the manufacturers to increase the savings to you"

Their international shipping policies are not known.

Cory Tobin notes: "Lab Depot sells pouches of pre-mixed TBE powder. For $22.71 you get enough to make 1L of 10x TBE. The usual working concentration of TBE is 1/2x, so this makes 20L of buffer. They don't mention only shipping to academic/commercial addresses so I suppose they will send the stuff to your apartment."

Culture Media

A recent question was asking where to find a supplier of amino acids for media. Sunrise Science Products (www.shop.sunrisescience.com) is good, primarily focused on basic yeast media. They also ship to residential addresses. Likely better purity than one would find at a GNC type store where there is no assurance of the actual content of any bottle.

Educational and kit suppliers

From the website : "Here at American Science & Surplus we are fascinated by discovery and invention. And we are dedicated to having fun along the way. We offer an eclectic range of products, many with a science or educational tilt to them, others simply handy or amusing. Value is important, and whenever we can, we carry surplus at prices well below retail. We love closeouts, inventory overruns, mis-manufactures, and items whose time has not come.

A word of caution: When a surplus item is gone, it is gone. So if you see something you love, best get it now since we may not have it tomorrow. When we can't find surplus, we may carry regular merchandise which we think those interested in learning and tinkering will find appealing, but only if we feel it is good quality at a fair price."

Note: does NOT ship outside of US territories

Surplus/Auction Equipment

please expand this list
  • LabX: http://labx.com/ LabX.com was founded in 1995 to provide a forum where buyers and sellers of new, used, surplus, and refurbished scientific and laboratory equipment could find items, negotiate terms, and complete transactions online. LabX is a media service for the exchange of scientific equipment. We neither buy nor sell equipment, but rather provide a means for buyers and sellers to connect.
  • Ebay and Ebay Healthcare, Lab and Life Sciences category: http://ebay.com/ EBay sells, just about everything - including lab equipment
  • Atlantic Lab Equipment http://www.atlanticlabequip.com/ Atlantic Lab Equipment's mission is to remove the risk from buying used lab equipment. Our discounted prices are not dirt-cheap, but we service and warranty all our products.
  • Biodirect http://www.biodirectusa.com/ Biodirect, the leading provider of the highest quality new and refurbished Lab Automation Products, HTS Systems, Detection Systems, & Lab Repair Services is pleased to announce their, not used but, certified pre-owned products available for sale. Additionally, our knowledgeable pre and post-sales support teams assist users in determining the best solutions for their needs. These are the our specialized products: 1) Liquid Handlers, 2) Microplate Readers, 3) Microplate Sealers, 4) Microplate Washers, 5) Microplate Labelers, 6) Thermal Cyclers, 7) PCR, 8) Dispensers, 9) Centrifuges, 10) Automated Stackers, 11) Automated Incubators & Microplate Storage Hotels, 12) Multimode Readers. Biodirect Inc. was incorporated in 2002 and is based in Taunton, Massachusetts. We don't sell products, we sell solutions!

Equipment list

See also DIYbio/FAQ/Projects.


Basic unorganized list of lab equipment.

  • accelerometer
  • ammeter
  • caliper
  • calorimeter
  • dna sequencer
  • dna synthesizer
  • dynamometer
  • electroscope
  • gravimeter
  • inclinometer
  • interferometer
  • magnetograph
  • mass spectrometer
  • micrometer
  • microscope
  • nmr spectrometer
  • ohmmeter
  • oscilloscope
  • seismometer
  • spectogram
  • spectrometer
  • telescope
  • time-of-flight mass spectrometer
  • theodolite
  • thermocouple
  • voltmeter
  • spin coater
  • transilluminator
  • gel box

Material analysis methods

  • AED - Auger electron diffraction
  • AES - Auger electron spectroscopy
  • AFM - Atomic force microscope
  • APS - Appearance potential spectroscopy
  • CAICISS - Coaxial impact collision ion scattering spectroscopy
  • CL - Cathodoluminescence
  • DVS - Dynamic vapour sorption
  • EBSD - Electron backscatter diffraction
  • EDX - Energy dispersive X-ray spectroscopy
  • EID - Electron induced desorption
  • EPMA- Electron Probe Microanalysis
  • ESCA - Electron spectroscopy for chemical analysis; see XPS
  • ESD - Electron stimulated desorption
  • EXAFS - Extended x-ray absorption fine structure
  • FEM - Field emission microscopy
  • FIM-AP - field ion microscopy-Atom probe
  • FTIR - Fourier transform infrared absorption spectroscopy
  • ATR (Attenuated Total Reflection)
  • GI (Grazing Incidence)
  • DRIFTS (Diffuse Reflectance)
  • GDMS - Glow discharge mass spectrometry
  • GDOS - Glow discharge optical spectroscopy
  • GISAXS - Grazing Incidence Small Angle X-ray Scattering
  • GIXD - Grazing Incidence X-ray Diffraction
  • GIXR - Grazing Incidence X-ray Reflectivity
  • HAS - Helium atom scattering
  • HREELS - High resolution electron energy loss spectroscopy
  • HRTEM - High-resolution transmission electron microscopy
  • IAES - Ion induced Auger electron spectroscopy
  • IGA - Intelligent gravimetric analysis
  • IIX - Ion induced X-ray analysis
  • INS - Ion neutralization spectroscopy
  • IRS - Infra Red spectroscopy
  • ISS - Ion scattering spectroscopy
  • LEED - Low energy electron diffraction
  • LEEM - Low-energy electron microscopy
  • LEIS - Low energy ion scattering
  • LIBS - Laser induced breakdown spectroscopy
  • LIPS - Laser induced plasma spectroscopy
  • LOES - Laser optical emission spectroscopy
  • LS - Light (Raman) scattering
  • MEIS - Medium energy ion scattering
  • NDP - Neutron depth profiling
  • NEXAFS - Near edge X-ray absorption fine structure
  • PD - Photodesorption
  • PDEIS - Potentiodynamic electrochemical impedance spectroscopy
  • PED - Photoelectron diffraction (also called XPD, PhD, ARPEFS)
  • PIXE - Particle (or proton) induced X-ray spectroscopy
  • RBS - Rutherford backscattering spectroscopy
  • Atomic absorption spectroscopy (AAS)
  • Atomic fluorescence spectroscopy (AFS)
  • Alpha particle X-ray spectrometer (APXS)
  • Capillary electrophoresis (CE)
  • Chromatography
  • Colorimetry
  • Cyclic Voltammetry (CV)
  • Differential scanning calorimetry (DSC)
  • Electron paramagnetic resonance (EPR)
  • Electron spin resonance (ESR)
  • Field flow fractionation (FFF)
  • Fourier transform spectroscopy (FTIR)
  • Gas chromatography (GC)
  • Gas chromatography-mass spectrometry (GC-MS)
  • High Performance Liquid Chromatography (HPLC)
  • Ion Microprobe (IM)
  • Inductively coupled plasma (ICP)
  • Instrumental mass fractionation (IMF)
  • Ion selective electrode (ISE) eg. determination of pH
  • Laser Induced Breakdown Spectroscopy (LIBS)
  • Mass spectrometry (MS)
  • Mossbauer spectroscopy
  • Nuclear magnetic resonance (NMR)
  • Particle induced X-ray emission spectroscopy (PIXE)
  • Pyrolysis - Gas chromatography - Mass spectrometry (PY-GC-MS)
  • Raman spectroscopy
  • Refractive index
  • Resonance enhanced multi-photon ionization (REMPI)
  • Scanning transmission X-ray microscopy (STXM)
  • Transmission electron microscopy (TEM)
  • X-ray fluorescence spectroscopy (XRF)
  • X-ray microscopy (XRM)
  • Scanning Probe Microscopy (SPM)
  • Scanning Tunneling Microscopy (STM)
  • Transmission Electron Microscopy (TEM)

FabLab Equipment Inventory

This data is also available in parsable YAML: http://diyhpl.us/cgit/skdb/plain/doc/BOMs/comparison/fablab.yaml

  • lab:
    • name: fablab
    • logo: http://fab.cba.mit.edu/about/logos/th_gcsh.rgb.600.jpg
    • link: http://fab.cba.mit.edu/about/fab/inv.html
    • inventory:
      • bulk shape creation:
        • oven Convection Toaster Oven/Broiler
        • silicone PDMS in Sylgard 184in 5.5lbs
        • mold compound in rub-r-moldin 5quarts
        • resin low viscosity 2quarts
        • resin hardener 2pints
        • cloth fiberglass 38in x90 (yd? in?)
        • silica colloidal 0.5gal
        • filler phenolic micro-balloon 0.5gal
        • filler wood flour 0.5gal
        • filler cell-o-fill 0.5gal
        • filler milled fibers 0.5gal
        • filler graphite powder 12oz
        • filler aluminum powder? 1lb
        • resin coloring blue red 0.3lb qty 2 each
        • plaster hydrostone 10gal
        • plaster drystone 10gal
        • urethane rubber for molding 20lbs
        • instamold 7.5lbs
        • flexwax 12.5lbs
      • joining:
        • solder station analog 50W
        • welder MIG 90A@19VDC gas-capable
        • laminator variable temperature
      • parting:
        • CNC plasma cutter
        • CNC vinyl cutter 2in * 27.5in 20in/s 0.3-2.5 newton
        • laser cutter Mini 24in x 12in 35W
        • scroll saw 20in Variable Speed
      • removal:
        • CNC milling machine 8in (X)x6in (Y)x2-3/8in (Z) 6500 rpm
        • cnc router (96x48x8in) 4HP spindle (shopbot)
        • dremel tool 35000rpm and accessories
        • router 1.75HP 23000rpm
        • grinder bench 6in 1/3HP
        • pencil sharpener
      • safety:
        • mask dust qty 30
        • mask welding qty 3
        • gloves welding pair medium large qty 3 each
        • earmuff qty 3
        • apron qty 3
        • ear-plugs
        • solder fume absorber
        • dust collector
        • gloves nitrile qty 200
      • power distribution:
        • transformer wall-wart 9V 1.5A, 24V 1.15A qty 10 each
        • power supply UPS
        • surge protector 7-outlets 12ft cord qty 5
        • cord extension 10ft
        • pneumatic coupler qty 3
        • hose rubber compressed-air 1/4in 25ft
      • materials:
        • wax machinable 4.3l
        • heatshrink tubing 1/16-1/2 by 1/8s x4ft black qty 5
        • cardboard havy duty 12000in^2
        • acrylic 1/8in 1440in^2
        • swab cotton qty 1000
        • wire magnet 30AWG 3000ft
        • vinyl tan garolite 1/32in 1440in^2
        • rubber mat 3/32in 1728in^2
        • film adhesive transfer 6in x180ft
        • tape masking 6in x180ft
        • film epoxy 6in x300ft
        • tape copper 6in x300ft*
        • vinyl yel red blue grn*
        • PCB stock FR1 .062 1/0 40in x48in machinable
      • consumables:
        • printer inkjet cartridges black color qty 3 each
        • pencil lead 0.7mm qty 180
        • pencil eraser qty 15
        • tape label 1/4in -3/4in qty 3 each
        • solder 0.020in 4lb
        • solder braid 0.050in 100ft
        • soldering tips flat/0.015in qty 5
        • stirrer 6in qty 500
        • dish weighing aluminum qty 1000
        • foil aluminum 0.001in x1in x500ft
        • zipties 6in reusable qty 500
        • zipties 15in reusable qty 125
        • glue stick 1/2in x4in 2lbs
        • tape double sided 1/2in x1000ft
        • cups polypropylene qty 250
        • cups plastic 5oz qty 500
        • cups plastic 10oz qty 250
        • cups plastic 16oz qty 250
        • wipes 9in x10.5in qty 1250
        • tape scotch qty 20
        • tape packaging qty 1.89in x 900ft
        • battery 9V alkaline qty 48
        • cd-rw qty 25
        • paper 2reams
        • marker sharpie black qty 12
        • laminator pouch small large qty 100 each
        • wire welding 0.030in flux-core 4lbs
        • tooling: #wtf is wrong with yaml, 2 spaces is not good enough?
          • saw blades for scroll saw
          • endmills carbide 0.01in -0.125in by 1/8in s qty 10 each
          • endmills carbide 0.015in -0.125in by 1/8in s ballnose qty 10 each
          • endmills carbide 1/8in 1/4in 1/2in by 1/2in 7/8in 1 1/8in by square ball qty 2 each
          • blades vinyl-cutter 45 degree qty 25
          • grinding wheel dresser
          • brush wire wheel 6in x 3/4in
          • router bits HSS set of 6
          • endmill HSS 3/16in qty 3
      • hand tools:
        • Heat Gun 750-800F
        • glue gun
        • screwdriver precision 6pc set qty 2
        • tweezers curved tip qty 20
        • wire stripper 30-20AWG qty 5
        • plier diagonal cutting qty 5
        • plier long nose qty 5
        • hex key set
        • wrench set 1/4in -7/8in
        • pliers locking 5in 6.5in 10in qty 1 each
        • clamp bar 12in qty 6
        • hammer welding
        • screwdriver ratcheting philips slot torx sq pozi qty 5
        • screwdriver hex ball-end set 0.05in -3/8in
        • file set of 5
        • file needle set qty 3
        • knife utility breakaway qty 10
        • scissors 8in qty 5
        • broom qty 3
        • dustpan qty 3
        • vacuum 9.6-Volt Cyclonic DustBuster
      • measuring:
        • Function Generator, 10 MHz DDS with Counter
        • Digital Storage Oscilloscope, 150 MHz, Color
        • magnifier loupe 10X 1in qty 10
        • test clip smd qty 5
        • multimeter w/freq+capacitance qty 3
        • ruler 6in decimal inch qty 10
        • scale digital 2000g max 0.1g resolution
        • caliper dial 6in max 0.001in graduations
        • measuring tape 50ft qty 6
        • cable BNC minihook, microhook qty 10 each
        • plug banana/bnc qty 10
        • adapter tee BNC-mm/ff qty 10
        • adapter usb serial qty 10
        • ruler 12in stainless qty 10
        • Power Supply, Triple Output, DC, Digital, 30V, 3A
        • Magnifier Light, IFM,5 DIOPTER, 45in ARM, CLAMP-ON
      • fixtures:
        • vise panavise jr qty 4
        • vise positioner "third hand" qty 5
        • clamps for shopbot
        • collets ER25 by 1/8in s
        • dispenser for packaging tape
        • dispenser for scotch tape
      • information:
        • TV/Monitor 10.2-Inch Widescreen LCD Color (videoconferencing)
        • ethernet switch 8port qty 2
        • router wireless
        • ethernet cable 3ft 5ft 7ft 10ft 25ft qty 5 each
        • printer scanner inkjet
        • printer inkjet
        • video conference device
        • video projector
        • books electronics and programming
        • computer 2.3GHz 2GB RAM qty 5
        • paper notebook qty 10
        • pen ballpoint blue qty 120
        • pencil mechanical 0.7mm qty 60
        • paper pads 5in x8in qty 36
        • printer label maker
      • storage:
        • bags antistatic 3x5-8x10 qty 100
        • bins cardboard 2,3,4,6,8in W 12in D 4in H qty 20 each
        • bins plastic small 2in qty 64
        • bins plastic large 4in qty 24
      • components:
        • (1206 SOD-123 SSOT SOT23 unless stated otherwise)
        • resistors 1/4W 0-10Mohm by 5s, 10s qty 1000 each
        • capacitor 1pF-0.1uF by 10s 50v qty 500 each
        • capacitor 1uF 50V qty 250
        • capacitor 3.3uF 16V qty 1000
        • capacitor 10uF 35V qty 100
        • capacitor radial 10F 2.7V qty 10*
        • choke coil 1-1000uH by 10s qty 25 each*
        • diode schottky 100V qty 500
        • diode zener 3.3V qty 500
        • diode zener 4.7V qty 500
        • mosfet n-ch 30V 1.7A qty 250
        • mosfet p-ch 30V 1.1A qty 250
        • mosfet n-ch 30V 12.5A qty 50
        • h-bridge 30V 2.3A qty 50 (sm8 package)
        • regulators LDO 3.3-5V 100mA qty 250 each
        • regulator LDO 5V 1A qty 100
        • LED red green qty 250 each
        • LED white rgb IR IR/flat qty 100 each
        • phototransistor black opaque clear qty 100 each
        • LCD module 16x2 characters qty 25
        • speaker 16x35mm 8ohm 0.5W qty 25
        • microphone condenser -40dB qty 50
        • thermistor 10kohm qty 25
        • opamp qty 100
        • microcontoller attiny45V 4kB 10MHz 8pins qty 200
        • microcontroller attiny44 4kB 20MHz 14pins qty 100
        • microcontroller atmega88 8kB 20MHz 32pins qty 50
        • resonator ceramic 20.00MHz qty 100
        • switch slidng 12V 100mA qty 50
        • switch tactile qty 100
        • magnets 0.25in and 0.5in dia by 0.125in thick qty 100 each
        • header and socket 64pin qty 10 each
        • jack power 2.1mm, 2.35mm, 2.75mm qty 100 each
        • jack phono qty 10
        • plug stereo 2.5mm qty 100
        • plug stereo 2.5mm qty 100 w/cover?
        • plug rca qty 50
        • connector db9 and db25 shell qty 25 each
        • cable ribbon 9conductor 300 ft*
        • battery snap 9v-style qty 100
        • battery holder 9v-style qty 50
        • battery holder AAA/N qty 100
        • connector ribbon cable 2,3,4,5 by rec/vert/RA qty 100 each
        • transducer ultrasonic 40kHz 112dB qty 10
        • motor step 7-16V by 4s 3.6-15deg qty 10 each
        • motor dc 6-24V by 6s 1.4A qty 10 each
        • motor dc 12v 110rpm gearhead qty 10