BME100 s2016:Group9 W1030AM L4
| Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||
|
OUR TEAMLAB 4 WRITE-UPProtocolMaterials
PCR Reaction Sample List
FINAL STEP: 72℃ for 2 minutes FINAL HOLD: 4℃
Research and DevelopmentPCR - The Underlying Technology
Template DNA: This is the sample DNA that you want to duplicate Primers: Primers are attached to the end of the segment of DNA you would like to copy. Tag Polymerase: Act like tiny machines that read the DNA and then attach matching nucleotides to create the DNA copies. Deoxyribonucleotides (dNTP’s): The nucleotide bases added to the growing DNA by the DNA polymerase
Initial Step: 95°C for 3 minutes: Causes the DNA to get ready to be separated to create two single-stranded DN
Adenine anneals to Thymine
During the anneal at 57°C, where the primers attach. And also during step two.
SNP Information & Primer DesignBackground: About the Disease SNP SNP's as defined, today, are markers of genetic variation found within the DNA of humans. These variation in DNA bases can warn doctors of disease or lead them to it, and while not all SNP's have direct negative health results, they can be indicative of very much about the body. The SNP examined in this experiment is located on the 19th human chromosome and it associated with the gene B3GNT3. This specific SNP is linked with the disease Non Hodgkin Lymphoma. The disease associated allele contains a change in sequence from CGC to CAC, at the numerical position 17811986 within the gene. Primer Design and Testing The forward and reverse primers found from the DNA near this SNP were GTGCGGGCTCCATCGCAACG and GGAGGAAGGTGTCGCCCCTT respectively. The IN SILICO PCR test, used to insure that the right forward and reverse non-disease primers were formulated, provided a 220 bp sequence, meaning that the primers created from the gene work correctly. (Click on image below to see results of test.) | ||||||||||||||||||||||||||||||||||





