|
OUR TEAM
LAB 4 WRITE-UP
Protocol
Materials
- Lab coat and disposable gloves
- PCR reaction mix, 8 tubes, 50 μL each: Mix contains Taq DNA polymerase, MgCl2, and dNTP’s (http://www.promega.com/resources/protocols/productinformationsheets/g/gotaqcolorlessmastermixm714-protocol/)
- DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer
- A strip of empty PCR tubes
- Disposable pipette tips: only use each only once. Never reuse disposable pipette tips or samples will be cross contaminated
- Cup for discarded tips
- Micropipettor
- OpenPCR machine: shared by two groups
PCR Reaction Sample List
| Tube Label |
PCR Reaction Sample |
Patient ID
|
| G8 + |
Positive control |
none
|
| G8 - |
Negative control |
none
|
| G8 1-1 |
Patient 1, replicate 1 |
97087
|
| G8 1-2 |
Patient 1, replicate 2 |
97087
|
| G8 1-3 |
Patient 1, replicate 3 |
97087
|
| G8 2-1 |
Patient 2, replicate 1 |
99041
|
| G8 2-2 |
Patient 2, replicate 2 |
99041
|
| G8 2-3 |
Patient 2, replicate 3 |
99041
|
DNA Sample Set-up Procedure
- gather all materials
- move extracted DNA into a PCR tube
- add primer 1 to PCR tube
- add primer 2 to PCR tube
- add nucleotides to PCR tube
- add DNA polymerase to PCR tube
- place PCR tube into DNA thermal cycler
OpenPCR program
HEATED LID: 100°C
INITIAL STEP: 95°C for 2 minutes
NUMBER OF CYCLES: 25
Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and
Extend at 72°C for 30 seconds
FINAL STEP: 72°C for 2 minutes
FINAL HOLD: 4°C
Research and Development
PCR - The Underlying Technology
Template DNA
The function of template DNA is to have an original strand of DNA used for replication in which the desired fragments of DNA can be extracted.
Primers
Primers are custom-made pieces of DNA that are synthesized in a laboratory and can be made out of any sequence of nucleotides that is desired. When used in polymerase chain reaction, primers are created so that they math the segment of template DNA that is desired to be replicated. One primer will attach to one strand of template DNA and bind using complementary base pairing. The other primer will attach to the other template DNA strand at the opposite end and bind using complementary base pairing. Primers are also vital to the polymerase chain reaction process because they allow DNA polymerase to attach to the template strand of DNA as well.
taq polymerase
Taq polymerase is used to string the floating nucleotides together, attached to the primer, to create a new DNA strand.
Deoxyribonucleotides (dNTP’s)
dNTP's are the nucleotides that are used to be strung together by taq polymerase to make a new strand of DNA.
Initial Step
The initial step of the PCR process is to raise the temperature to 95 degrees Celsius for three minutes. After this, for 30 seconds the denature step occurs. At this step, the DNA helix separates, leaving two single strands of DNA nucleotides.
Anneal
At this step, the temperature is cooled to 50 degrees celsius. At this step, the single strands of DNA try to pair again with each other, yet the primers keep this from happening. There are many more primers present in the PCR tube than there are DNA strands, so the primers are able to bind to the single DNA strands before the helix can form again.
Extend, Final step, &Final Hold
At this step the temperature is then raised to 72 degrees celsius. This then triggers the DNA polymerase to locate a primer that is attached to a single DNA strand. After 30 seconds, the final step occurs in which he DNA polymerase then begins to add complementary nucleotides. The last 4 seconds, called the final hold, of this process triggers the DNA polymerase to step adding nucleotides to the strand until it reaches the end.
DNA Nucleotides
There are four nucleotides that are present in a strand of DNA. Each is a complementary nucleotide to one other nucleotide found in the sequence. The way in which their pair is listed below as:
Adenine (A): pairs with Thymine(T)
Thymine(T): pairs with Adenine(A)
Guanine(G): pairs with Cytosine(C)
Cytosine(C):pairs with Guanine(G)
Base Pairing Steps
The two steps in which DNA base pairing occurs is Anneal and Extend. This is because during anneal, the primers bind to the strand and prevent the single strands from forming a double helix. During the extend step, the DNA polymerase finds the primers which are attached to the single DNA strands and then begins to add complementary nucleotides.
SNP Information & Primer Design
Background: About the Disease SNP
The disease SNP associated with B3GNT3 is affected by a point mutation in human chromosome 19. The mutation results in a codon change from CGC to CAC and can occur at different positions depending on the variant. This codon change results in the mutation of the an arginine to a histidine in the final protein. The non-disease variant performs N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity, beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity, and galactosyltransferase activity. A mutation in the protein results in a missense function of the protein. The disease SNP has been linked to a risk of non-hodgkin lymphoma.
Primer Design and Testing
To distinguish the non-disease SNP from the disease SNP 3 different primers will be need. All primers were designed with a length 20 nt. The forward primer for the non-disease SNP, GTGCGGGCTCCATCGCAACG, begins 19 bases upstream from the SNP and ends with the SNP (20 nt total). The forward primer for the disease SNP, GTGCGGGCTCCATCGCAACA, differs from that of the non-disease primer only by one base at the end where the mutation from G to A occurs. The reverse primer, GGAGGAAGGTGTCGCCCCTT, is shared by both variants and begins 200 bases upstream from the SNP. The non-disease primer pair is found in the database:
Error creating thumbnail: Unable to save thumbnail to destination
While the disease primer is not:
Error creating thumbnail: Unable to save thumbnail to destination
| 
BME 100 Spring 2016
