BME100 s2016:Group4 W1030AM L4

BME 100 Spring 2016	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Desiree Yazzie Role(s) Name: Sara Gubrud Role(s) Name: Katerina Soltero Role(s) Name: Patrick Panattoni Role(s) Name: Karson Pooler Role(s) Name: Paul Gossett Contributor LAB 4 WRITE-UP Protocol Materials Lab coat and disposable gloves PCR reaction mix, 8 tubes, 50μL: Mix contains Taq DNA polymerase, MgCl_2, and dNTP's DNA/ primer mix, 8 tubes, 50μL each: Each mix contains aq different template DNA. All tubes have the same forward primer and reverse primer. A strip of empty PCR tubes Disposable pipette tips: only use each only once. Never re-use dispoable pipette tipse or samples will be cross-contaminated Cup for discarded tip-s Micropipettor OpenPCR machine: shared by two groups PCR Reaction Sample List Tube Label PCR Reaction Sample Patient ID G4 + Positive control none G4 - Negative control none G4 1-1 Patient 1, replicate 1 59736 G4 1-2 Patient 1, replicate 2 59736 G4 1-3 Patient 1, replicate 3 59736 G4 2-1 Patient 2, replicate 1 70858 G4 2-2 Patient 2, replicate 2 70858 G4 2-3 Patient 2, replicate 3 70858 DNA Sample Set-up Procedure Create labels according to the table to avoid confusion between the patients. Place the tubes in order in the test tube rack. Transfer 50μL of PCR reaction mix into the tube labelled positive control. Make sure to replace pipette tips. Transfer control DNA into the positive control tube. Repeat steps 3 and 4 for the negative control, patient 1 samples, and patient 2 samples. Close the lids on each tube and place in the PCR machine. When 16 samples are in the PCR machine start it. OpenPCR program HEATED LID: 100°C INITIAL STEP: 95°C for 2 minutes NUMBER OF CYCLES: 25 Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and Extend at 72°C for 30 seconds FINAL STEP: 72°C for 2 minutes FINAL HOLD: 4°C Research and Development PCR - The Underlying Technology Base-pairing Base-pairing occurs in the annealing stage of thermal cycling, when the bases on each of the two primers attach to the corresponding bases on the target regions of DNA. It also occurs during the extension stage, when free-floating nucleotides are captured by Taq polymerase and used to synthesize new DNA sequences, whose bases are paired with the target sequences. SNP Information & Primer Design Background: About the Disease SNP Nucleotides are organic molecules that serve as subunits in DNA and RNA. They are composed of a base (adenine, thymine, guanine, or cytosine), a sugar molecule, and phosphoric acid. Polymorphism is the ability to process objects differently or redefine methods. Primer Design and Testing Part 1: The SNP rs36686 is found in Homo sapiens and is located on chromosome 19. Its clinical significance is listed as "NA". This SNP is attributed to immune and inflamation genes and risk of non-Hodgkin lymphoma. It is associated with the B3GNT3 gene. Below is a screenshot taken from the National Center for Biotechnology (NCBI) webpage on rs36686 SNP. Part 2: B3GNT3 stands for UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3. B3GNT3 is a gene that takes part in several processes: O-glycan, carbohydrate metabolic, and cellular protein metabolic. The non-disease allele is CGC. A change of the middle base will result in a disease-associated allele, CAC. An allele is a variant form of a gene. The numerical position of the SNP is 17811986. Part 3: Primer pairs were then prepared for PCR. The non-disease forward primer is 5'GTGCGGGCTCCATCGCAACG, and the non-disease reverse primer is 5'GGAGGAAGGTGTCGCCCCTT. A pair of disease SNP-specific primers were also designed. The disease forward primer is 5'GTGCGGGCTCCATCGCAACA. The disease forward primer is the same as the non-disease forward primer, except that the last SNP is A, instead of G (CGC). The different middle base, CAC, is the disease associated allele. The disease reverse primer is the same as the non-disease reverse primer: 5'GGAGGAAGGTGTCGCCCCTT. The non-disease reverse primers were validated using a non-disease human genome sequence. The result was a 220 bp sequence located on the same chromosome (19) as the one recorded on the rs36686 webpage. This means the non-disease primers will work for a PCR reaction.