BME100 s2016:Group3 W1030AM L4

From OpenWetWare
Jump to navigationJump to search
BME 100 Spring 2016 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help


OUR TEAM

Name: Mark Weser
Name: Ryan Wood
Name: Kori Staples
Name: Morgan Murphy
Name: Alexis Nelson
Name: Makarios Begay

LAB 4 WRITE-UP

Protocol

Materials

  • Lab coat and disposable gloves
  • PCR reaction mix, 8 tubes, 50 μL each: Mix contains Taq DNA polymerase, MgCl 2 , and dNTP’s
  • DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer
  • A strip of empty PCR tubes
  • Disposable pipette tips: only use each only once. Never reuse disposable pipette tips or samples will be cross-contaminated
  • Cups for discarded tips
  • Micropipettor
  • OpenPCR machine: shared by two groups

PCR Reaction Sample List

Tube Label PCR Reaction Sample Patient ID
G3 + Positive control none
G3 - Negative control none
G3 1-1 Patient 1, replicate 1 35239
G3 1-2 Patient 1, replicate 2 35239
G3 1-3 Patient 1, replicate 3 35239
G3 2-1 Patient 2, replicate 1 54995
G3 2-2 Patient 2, replicate 2 54995
G3 2-3 Patient 2, replicate 3 54995


DNA Sample Set-up Procedure

  1. Add the extracted DNA to PCR tube.
  2. Add the primers to the PCR tube.
  3. Add nucleotides (dNTPs) to the PCR tube.
  4. Add DNA polymerase to the PCR tube.
  5. Place the tube in the DNA thermal cycler.


OpenPCR program
HEATED LID: 100°C
INITIAL STEP: 95°C
NUMBER OF CYCLES: 25

Denature at 95°C for 30 seconds, Anneal at 57°C
for 30 seconds, and Extend at 72°C for 30 seconds

FINAL STEP: 72°C for 2 minutes
FINAL HOLD: 4°C


Research and Development

PCR - The Underlying Technology
Components of PCR
1. Functions of PCR Components:

"Template DNA:" the non-coding strand of a gene in DNA "Primers:" a strand of short nucleic acid sequences that serve as the starting point for DNA replication "Taq Polymerase:" a method for greatly amplifying short segments of DNA "Deoxyribonucleotides (dNTP’s):" the monomer, or single unit, of DNA, or deoxyribonucleic acid. (contains components for PCR)

2.What happens to the components (listed above) during each step of thermal cycling?

“INITIAL STEP”: Add the DNA, primers, polymerase, and nucleotides to one test tube. “Denature”: The double stranded DNA template breaks apart when heated and becomes a single strand, because the weak hydrogen bonds break in higher temperatures. “Anneal”: At this lower temperature, the DNA strands want to pair together again. However, the primer sequences crowd the DNA and attach. “Extend”: When the temperature is increased to 72°C, the polymerase are activated and attach to the primer and DNA. The polymerase act as organizers for the nucleotides and add them to the single strands of DNA to their complementary nucleotide (A-T and G-C). “FINAL STEP”: Repeat these steps 20-30 times by raising and lowering the temperature to allow the DNA to replicate. During the third cycle, your desired segments of DNA start to appear. “FINAL HOLD”: Slows the DNA replication process to a near stop in order for it to be examined as a preserved image.

3. Adenine always binds to Thymine forming one pair, and Guanine and Cytosine form the other base pair.
4. During which two steps of thermal cycling does base-pairing occur? Explain your answers.
During thermal cycling base pairing occurs during Annealing and Extending. During Annealing, the temperature is lowered (to 57 degrees C) and primers attach to the specified DNA strand. During Extending, the temperature is then raised (to 72 degrees C) which allows the polymerase to match to the bases. Together, these two steps make up the process of base-pairing.




SNP Information & Primer Design

Background: About the Disease SNP

Part 1:
Nucleotide: Subunits of DNA and RNA consisting of a nitrogenous base, a five-carbon sugar, and one phosphate group.
Polymorphism: The occurrence of two or more distinctly different morphs or phenotypes (Jaguar vs. Black Jaguar).
Species found in: Homo sapiens
Chromosome found in: 19:17811986
Clinical Significance: None
Gene: B3GNT3
Disease: non-Hodgkin lymphoma

"Non-Hodgkin's Lymphoma Summary:"

Non-Hodgkin's Lymphoma or NHL, is a series of blood cancers that include every type of blood cancer except Hodgkin's Lymphoma. It can be passed down genetically, or it can be caused by exposure to certain toxic chemicals, autoimmune disease, HIV and Hepatitis, and through over exposure to radiation. The five year survival rate for this form of cancer is 69% and every 9 minutes, one person dies from a form of Non-Hodgkin's Lymphoma, which is 155 each day. Treatments for this type of cancer are chemotherapy, radiation therapy, STEM-cell transplants, and specialized medications. This cancer shows up on the body in the form of tumors on the lymph nodes. Abdominal and chest pain are also common symptoms of Non-Hodgkin's Lymphoma.


Part 2:
B3GNT3 stands for UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3.
Its function is N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltrasferase activity, beta-1,3-galactosyl-O-glycosyl-glycoprotien beta-1,3-N-acetylglucosaminyltransferase activity, and galactosytransferase activity.
Allele: A variant form of a gene
Disease-associated allele sequence: CAC (instead of CGC)
Position: 17811986


Primer Design and Testing

Part 3:
Non-disease forward primer: GTGCGGGCTCCATCGCAACG
Numerical position: 1712186
Non-disease reverse primer: GGAGGAAGGTGTCGCCCCTT
Disease forward primer: GTGCGGGCTCCATCGCAACC
Disease reverse primer: GGAGGAAGGTGTCGCCCCTT
Non-disease primer
Disease primer