|
OUR TEAM
LAB 4 WRITE-UP
Protocol
Materials
- Lab coat and disposable gloves
- PCR reaction mix, 8 tubes, 50 μL each: Mix contains Taq DNA polymerase, MgCl2
, and dNTP’s
- DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes
have the same forward primer and reverse primer
- A strip of empty PCR tubes
- Disposable pipette tips: only use each only once. Never reuse disposable pipette tips or
samples will be crosscontaminated
- Cup for discarded tips
- Micropipettor
- OpenPCR machine: shared by two groups
PCR Reaction Sample List
| Tube Label |
PCR Reaction Sample |
Patient ID
|
| G16 + |
Positive control |
none
|
| G16 - |
Negative control |
none
|
| G16 1-1 |
Patient 1, replicate 1 |
29688
|
| G16 1-2 |
Patient 1, replicate 2 |
29688
|
| G16 1-3 |
Patient 1, replicate 3 |
29688
|
| G16 2-1 |
Patient 2, replicate 1 |
65775
|
| G16 2-2 |
Patient 2, replicate 2 |
65775
|
| G16 2-3 |
Patient 2, replicate 3 |
65775
|
DNA Sample Set-up Procedure
- In order to perform PCR reaction:
- 1- Eight test tubes were used labeled G16 P, G16 N, G16 1-1, G16 1-2, G16 1-3, G16 2-1, G16 2-2, G16 2-3.
- 2- For the G16 + test tube the DNA from a person who tested positive for the disease SNP was inserted, this is our positive control
- 3- For the G16 - test tube the DNA from a person who does not carry the disease SNP was inserted, this is our negative control
- 4- For the G16 1-1,1-2,1-3, DNA from patient 1 was inserted.
- 5- This was repeated for G16 2-1,2-2,2-3 with DNA from patient 2
- 6- 50 μL of PCR reaction mix containing Taq DNA polymerase, MgCl , and dNTP’s was inserted into each of the test tubes using a micropipette.
- 7- 50 μL of DNA/primer mix was inserted into each of the test tubes using a micropipette.
- 8- After each test tube was injected with a material the tip was disposed of in a discard cup and a new tip was put on. This was done to ensure no cross contamination and a sterile field.
- 9- Steps 4-7 were repeated for patient two.
OpenPCR program
-Thermal Cycling Program--
- Heat Lid: 100°C
- Step 1 : 95°C for 2 minutes
- Number of Cycles:35
- Step 2 Denature at 95°C for 30 seconds
- Step 3 Anneal at 57°C for 30 seconds
- Step 4 Extend at 72°C for 30 seconds
- Final step: 72°C for 2 minutes
- Final holding temp: 4°C
https://www.genome.gov/10000207
Research and Development
PCR - The Underlying Technology
- function of each component of a PCR reaction:
the function of the tempelate DNA is that it is the it is the original strand that is replicated during PCR. while the primer's function is detecting the beginning and end of the segment of the template DNA that needs to be replicated. Primers are actually small pieces of DNA (codons) that mark the where the replication beigns. Taf Polymerase protein function is assembling the new strand of DNA along the template strand. dNTP's function is that it is the individual base pairs used to assemble the new strand of DNA
- what happens at different temperatures during the PCR (polymerase Chain Reaction):
At 95 for 3 minutes, the template DNA strand is unwrapped. While at 95 for 30 seconds, the template DNA is separated into its two strands. then at 57 for 30 seconds, primers are added to the two strands. After that, at 72 for 30 seconds, Taq Polymerase is added to the two strands at the primer point. Finally, at 72 for 3 minutes, the DNA is replicated from the beginning primer to the end primer
The Base pair A ( Adenine) pairs binds with with base pair T (Thymine). While base pair C ( cytosine) pairs with base pair G (Guanine).
- Time when Base pairing occurs
Base pairing occurs near the end of each thermal cycling because base pairing binding starts when the DNA primers get attached to the matching base pairs in the original DNA strand, and it also happens again when the enzyme tac polymerase get attached to the DNA strands at higher temperature, matching up the nucleotides to strengthen the DNA strands.
SNP Information & Primer Design
Background: About the Disease SNP
SNP stands for nucleotide polymorphism. Nucleotides are organic molecules that are sometimes referred to as the “building blocks” of life. The “building blocks” of life are composed of four molecules called adenine, cytosine, thymine, and guanine. These four organic molecules are combined in many different combinations, but each combination serves its own important purpose and therefore are the foundation for DNA. Polymorphism is an occurrence in which DNA is varied. The result of this DNA variation occurs when two or more different phenotypes exist in the same population of a species. This change in DNA can lead to unwanted protein creations which can cause major diseases. Found in the species Homo Sapien, this specific disease SNP is suggested in many smaller scale evaluations to predispose the patient to non-Hodgkin lymphoma. The ID for this gene is B3GNT3.
- What is the function of B3GNT3? To find out, click the B3GNT3 link. Under Table of Contents (right side) click Gene ontology. Write the first three unique terms you see.
Oglycan processing, carbohydrate metabolic process, cellular protein metabolic process
- What is an allele? - An allele is one of two or more versions of a gene.
- The disease-associated allele contains what sequence? – CAC
- The numerical position of the SNP is - Position: 17811986
Primer Design and Testing
There are 4 primers, each of length 20nt, needed in order to distinguish between the mutated or diseased SNP, and the non mutated, or healthy SNP. There is a forward and reverse primer for each SNP
The forward primer for the healthy SNP, GTGCGGGCTCCATCGCAACG.
The reverse primer for the healthy SNP, GGA GGA AGG TGT CGC CCC TT.
The forward primer for the diseased SNP, GTGCGGGCTCCATCGCAACA.
The reverse primer for the diseased SNP, GGAGGAAGGTGTCGCCCCTT.
The reverse primer, GGAGGAAGGTGTCGCCCCTT, is seen in both sequences and starts 200 bases from the SNP.
These sequences were entered into the UCSC In-Silico PCR web tool, and matched to the 15th chromosome.
|
BME 100 Spring 2016
