|
OUR TEAM
LAB 4 WRITE-UP
Protocol
Materials
- Lab coat and disposable gloves
- PCR reaction mix, 8 tubes, 50 μL each: Mix contains Taq DNA polymerase, MgCl2, and dNTP’s
- DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer
- A strip of empty PCR tubes
- Disposable pipette tips: only use each only once. Never reuse disposable pipette tips or samples will be crosscontaminated
- Cup for discarded tips
- Micropipettor
- OpenPCR machine: shared by two groups
PCR Reaction Sample List
| Tube Label |
PCR Reaction Sample |
Patient ID
|
| G14 + |
Positive control |
none
|
| G14 - |
Negative control |
none
|
| G14 1-1 |
Patient 1, replicate 1 |
20710
|
| G14 1-2 |
Patient 1, replicate 2 |
20710
|
| G14 1-3 |
Patient 1, replicate 3 |
20710
|
| G14 2-1 |
Patient 2, replicate 1 |
35451
|
| G14 2-2 |
Patient 2, replicate 2 |
35451
|
| G14 2-3 |
Patient 2, replicate 3 |
35451
|
DNA Sample Set-up Procedure
- Step 1 Move the extracted DNA into a PCR tube
- Step 2 Add primer 1 to the PCR tube
- Step 3 Add primer 2 to the PCR tube
- Step 4 Add the nucleotides to the PCR tube
- Step 5 Add the Taq DNA Polymerase to the PCR tube
- Step 6 Place the PCR tube into the DNA Thermal Cycler
OpenPCR program
- HEATED LID: 100°C
- INITIAL STEP: 95°C for 2 minutes
- NUMBER OF CYCLES: 25
- Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and
- Extend at 72°C for 30 seconds
- FINAL STEP: 72°C for 2 minutes
- FINAL HOLD: 4°C
Research and Development
PCR - The Underlying Technology
DNA Template are the sample DNA that contains the target sequence. Firstly with the reaction, high temperature is applied to the original double-stranded DNA molecule to separate the strands from each other. The original double-stranded DNA has high temperature applied to it, this cause separation with the strands. Primers are DNA, which are short and single-stranded that help the target sequence. The polymerase begins synthesizing new DNA from the end of the primer. Taq polymerase. An enzyme help regulate the replication of DNA. Deoxyribonucleotides-The four different dNTP’s, which are adenine (A), guanine (G), cytosine (C), and thymine (T), are used to help with DNA replication by having “building blocks”.
The six steps in thermal cycling include: where the temperature is 95℃ for three minutes. This steps is where the DNA is prepared for denaturation by using heat. The next denaturing step, which lasts for 30 seconds at 95℃, the DNA strands are separated from each other. The step after that which changes the temperature to 57°C for 30 seconds, is called the annealing step. This part of the cycle occurs before the two strands of DNA template come together, and then the primers will be attached to their respected target sites. The following step is the extended cycle step at the temperature 72℃ for 30 seconds. This step has the tag polymerase initiated that locates the primers. The final step lasts for 3 minutes at 72℃; the tag polymerase will begin adding deoxyribonucleotides, which will stop when it reaches the end of the strand. The final hold occurs at 4°C, which is when the overall PCR reaction comes to an end.
The Adenine (A) and Thymine (T) base anneals are attached together while the Cytosine (C) and Guanine (G) are attached together.
The two steps of base-pairing in thermal cycling occurs in between the steps of Annealing and Extending. During Annealing (step 3), the primer is attached to the separated DNA strand due to the temperature being dropped to 57°C. During Extending (step 4), the DNA polymerase are attached to the primer from the temperature raised to 72. The DNA polymerase then allows complementary nucleotide bases to attach to the respected bases in the first DNA strand. The use of steps Annealing and Extending act as the phases for base-pairing to occur.
SNP Information & Primer Design
Background: About the Disease SNP
Nucleotides are molecules that are organic and become monomers, the building blocks of nucleic acids. Which is like DNA and RNA. A polymorphism is when there is a variation in a particular DNA sequence that happens at the same time involving two or more nucleotides of the DNA. Disease SNP can help determine one's susceptibility to disease.
Primer Design and Testing
In the disease SNP-specific lab, the species the variation of this SNP was found in was Homosapians. The chromosome the variation was located on was chromosome 19: 17811986
This SNP had N/A and the risk of non-Hodgkin Lymphome disease listed as the Clinical Significance. The gene associated with this SNP was B3GNT3. The disease linked to this SNP was Non-Hodgkin Lymphome disease.
The gene, B3GNT3, stands for UDP-G1cNAc: betaGal beta-1, 3-N-acetylglucoseaminytransferase 3. This also serves as its function.
An allele is a variation of a gene, meaning a different form of that one gene. The disease associated allele in this SNP was (AAA or CAC). The numerical position of the SNP was position # 171811780
The non-disease forward primer was 5’- GTGCGGGCTCCATCGCAACG
The numerical position exactly 200 bases to the right of the disease SNP is 171811986. The non-disease reverse primer was GGGCTGGTTCAGCGCATCCC. The disease former primer was GTGCGGGCTCCATCGCAACC. The disease reverse primer was GGGCTGGTTCAGCGCATCCC.
The primers were validated as correct through the use of a non-disease human genome sequence online.
Error creating thumbnail: Unable to save thumbnail to destination
|
BME 100 Spring 2016
