BME100 s2015:Group4 12pmL5

BME 100 Spring 2015	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Error creating thumbnail: File missing Name: Sydney Wallace Error creating thumbnail: File missing Name: Nima Sadeghi Error creating thumbnail: File missing Name: Fatimah Alhabib Error creating thumbnail: File missing Name: Jonathan Moroneso LAB 5 WRITE-UP Procedure Smart Phone Camera Settings Type of Smartphone: iPhone 5s Flash: Off ISO setting: N/A White Balance: N/A Exposure: N/A Saturation: N/A Contrast: N/A Calibration Distance between the smart phone cradle and drop = 8.7cm Solutions Used for Calibration Initial Concentration of 2X Calf Thymus DNA solution (micrograms/mL) Volume of the 2X DNA Solution (μL) Volume of the SYBR GREEN I Dye Solution (μL) Final DNA concentration in SYBR Green I solution (μL) 5 80 80 2 2 80 80 1 1 80 80 0.5 0.5 80 80 0.25 0.25 80 80 0.125 0.0 80 80 0.0 Placing Samples onto the Fluorimeter Put on your lab coat and a pair of gloves. Set up camera and slide. Make sure that the camera is at least 4 cm away from the slide. Pick up the micropipette and set it to 80 microliters. Put a new tip on the micropipette. Put the micropipette into the cyber green and collect 80 microliters. Put the cyber green onto the slide using the first two open spaces in the middle of the slide. Eject tip from micropipette and put a new one on. Put the micropipette inside of the positive control and take 80 microliters. Place the positive control inside of the cyber green that is currently on the slide. Turn on the blue light. Take 3 pictures of the mixture. Repeat these steps for the next 5 mixtures. Data Analysis Representative Images of Negative and Positive Samples Negative Sample Error creating thumbnail: File missing Positive Sample Error creating thumbnail: File missing Image J Values for All Calibrator Samples Final DNA Concentration in SYBR Green I Solution (µg/mL) AREA Mean Pixel Value RAWINTDEN of the drop RAWINTDEN of the background RAWINTDEN Drop - BACKGROUND 2.5 331364 198.732 65852597 17649621 48202976 2.5 342228 199.351 68223421 16724921 51498500 2.5 250184 199.324 49867751 1240020 48627731 1 296560 198.506 58868847 10437897 48430950 1 281220 197.943 55665421 10138481 45526940 1 298592 182.37 54454217 9172072 45282145 0.5 348032 174.117 60598450 10459380 50139070 0.5 440128 173.75 76472163 12152830 64319333 0.5 528596 58.82 31092099 1129060 29963039 0.25 464696 145.554 67638160 11353152 56285008 0.25 718056 52.967 38032999 1626013 36406986 0.25 686180 150.246 103096002 19177502 83918500 0.125 680324 56.656 38544379 6472829 32071550 0.125 504300 124.562 62816687 21802388 41014299 0.125 516896 124.628 64419793 22990441 41429352 0 611476 38.406 23484622 4934774 18549848 0 524308 109.757 57546518 21610863 35935655 0 647168 108.69 70340542 27210814 43129728 Final DNA Concentration in SYBR Green I Solution (µg/mL) R1 R2 R3 RAWINTDEN Mean Standard Deviation 2.5 48202976 51498500 48627731 49443069 1792680.019 1 48430950 45526940 45282145 46413345 1751578.888 0.5 50139070 64319333 29963039 48140480.67 17265123.92 0.25 56285008 36406986 83918500 58870164.67 23861019.82 0.125 32071550 41014299 41429352 38171733.67 5286988.54 0 18549848 35935655 43129728 32538410.33 12637190.3 Calibration curve PCR Results Summary PCR Dilutions: PCR Tube Label Volume of Diluted PCR Product Solution (μL) Volume of SYBR Green I Dye Solution (μL) Dilution 1 Dilution 2 Total Dilution (simplified fraction) G4 + 80 80 (1/6) 0.5 (1/12) G4 - 80 80 (1/6) 0.5 (1/12) G4 1-1 80 80 (1/6) 0.5 (1/12) G4 1-2 80 80 (1/6) 0.5 (1/12) G4 1-3 80 80 (1/6) 0.5 (1/12) G4 2-1 80 80 (1/6) 0.5 (1/12) G4 2-2 80 80 (1/6) 0.5 (1/12) G4 2-3 80 80 (1/6) 0.5 (1/12) PCR ImageJ Chart: PCR Tube Label Area Mean Pixel Value RAWINTDEN of the drop RAWINTDEN of the background RAWINTDEN Drop - BACKGROUND G4 + 238260 206.528 49207455 8102221 41105234 G4 + 475036 82.259 39075423 2140855 36934568 G4 + 614748 81.835 50307831 2596113 47711718 G4 - 453896 166.741 75683044 15204655 60478389 G4 - 389668 70.07 27303846 1608565 25695281 G4 - 453300 67.805 30735807 1856974 28878833 G4 1-1 461720 66.512 30710099 1664280 29045819 G4 1-1 501084 69.275 34712669 1923263 32789406 G4 1-1 407032 185.24 75398569 15819040 59579529 G4 1-2 382272 185.781 71018867 14446760 56572107 G4 1-2 379832 185.004 70270329 12930916 57339413 G4 1-2 546620 77.236 42218650 2009507 40209143 G4 1-3 424532 171.574 72838811 13651183 59187628 G4 1-3 350160 169.812 59461422 1054940 58406482 G4 1-3 636212 79.321 50465104 2529074 47936030 G4 2-1 342228 176.669 60461158 8916351 51544807 G4 2-1 352960 193.364 68249727 10442955 57806772 G4 2-1 477744 195.703 93495795 9042113 84453682 G4 2-2 327048 192.788 63050943 9830362 53220581 G4 2-2 627364 192.629 120848790 16995345 103853445 G4 2-2 513836 193.179 99262128 13887770 85374358 G4 2-3 305496 155.534 47514967 7818637 39696330 G4 2-3 257640 66.847 17222497 772354 16450143 G4 2-3 234740 183.909 43170690 7086446 36084244 PCR DNA Calculations: PCR Tube Label RAWINTDEN Mean PCR Product Concentration (μg/mL) Initial PCR Product Concentration (μg/mL) G4 + 41917173.33 0.639057778 0.053254815 G4 - 38350834.33 -0.549721889 -0.045810157 G4 1-1 40471584.67 0.157194889 0.013099574 G4 1-2 51373554.33 3.791184778 0.315932065 G4 1-3 55176713.33 5.058904444 0.42157537 G4 2-1 64601753.67 8.200584556 0.683382046 G4 2-2 80816128 13.605376 1.133781333 G4 2-3 30743572.33 -3.085475889 -0.257122991 Our positive control PCR result was 0.053254815 μg/mL Our negative control PCR result was -0.045810157 μg/mL Observed results Patient 16819 : The droplets for patient 16819 had a big green area of DNA in the middle of the drops. DNA was not found around the top or bottom of the drop. Small amounts of green touched the sides of the droplet. Based on the calculation the amount of DNA for patient 16819 is 0.250202 μg/mL. Patient 59134 : The droplets for patient 59134 had more green in comparison to those of patient 16819. The green concentrated in the middle, touched the tops of the droplets, more densely touched the sides of the droplets, and still did not touch the bottom. Based on the calculation the amount of DNA for patient 59314 is 0.520013. Conclusions Patient 16819 : After a comparison of the values of positive and negative controls compared to the values of patient 16819, it was determined that the values fell closer to the positive control. For this reason patient 16819 was determined to be positive for SNP. Patient 59134 : After a comparison between the values of the positive and negative controls to the values of patient 59134, it was determined that the patient's values fell closer to the positive control. Because of this, patient 59134 was determined to be positive for SNP. Error Analysis: Errors were known to have occurred because some of the values obtained are impossible (negative values). The software was used correctly with accordance with the procedure explained in the Lab Workbook. After examination, some of the error can be attributed to different sized images of the droplets because they were taken with different zooms, causing error in the ImageJ calculations. The camera was alinged manually to the droplet each time, but zooming was necessary, and a standard zoom was not determined at the time of taking the pictures. SNP Information & Primer Design Background: About the Disease SNP Part 1: What is a Nucleotide? A nucleotide is the primary building block of nucleic acids. They are composed of a nitrogenous base, a five-carbon sugar, and a phosphate group. What is a Polymorphism? A polymorphism is when two different phenotypes exists in the same population. For example, there are cheetahs who display a spotted fur, and there are cheetahs who display black fur. rs268 This variation is found in homo sapiens. The variation is located on chromosome 8 The clinical significance of this SNP is that it is pathogenic. This SNP is associated with the LPL gene A disease associated with this SNP is Coronary Heart Disease Part 2: LPL stands for Lipoprotein Lipase The LPL has several functions: apolipoprotein binding heparin binding lipoprotein lipase activity An allele is a varying form of a gene. The disease-associated allele contains the sequence: AGT The numerical position of the SNP is: 19956018 Primer Design and Testing When run through the primer test, the non-diseased primer was found to be in the human genome. This is because it is normally produced in the body. Conversely, the diseased primer returned no match because it does not appear in a healthy human genome, as it is a mutation. The non-disease forward primer (20 nt): 5’ AATCTGGGCTATGAGATCAA The numerical position exactly 200 bases to the right of the disease SNP is: 19956218 The non-disease reverse primer (20 nt): 5’ TGGGACTCGGGACCACAAAG Disease forward primer (20 nt): 5’ AATCTGGGCTATGAGATCAG Disease reverse primer (20 nt): 5’ TGGGACTCGGGACCACAAAG